• 전문가 요청 쿠폰 이벤트
  • 통합검색(50)
  • 리포트(45)
  • 시험자료(3)
  • 논문(1)
  • 방송통신대(1)
  • 기간
  • 연관순
  • 영역
  • 페이지 수
  • 확장자
  • 할인자료 보기

연관검색어

central dogma 실험 pcr 종류 watson and crick 3T3-L1 qPCR electrochemical Conventional PCR pCRdna검사
AI
AI 글쓰기
'complementary reading' 초안, 3분이면 완성
AI가 맞춤 레포트 초안을 작성해 드립니다.
지금 시작하기 →
판매자 표지는 다운로드시 포함되지 않습니다.

"complementary reading" 검색결과 1-20 / 50건

  • 자료 표지
    상보적 읽기가 대학생들의 읽기능력에 미치는 영향 (Effects of Complementary Reading for College Students’ Reading Skills)
    21세기영어영문학회 강은영, 이화자
    논문 | 21페이지 | 무료 | 등록일 2025.05.22 | 수정일 2025.05.26
    다운로드
  • 자료 표지
    동물유전과개량 ) Central dogma에 대해 기술하고, DNA, RNA, 단백질 각각의 분석 방법에 대하여 기술하시오
    , nucleotide sequence가 ACA인 DNA를 template로 하는 경우, transcription 되는 mRNA는 UGU라는 complementary sequence를 가지 ... 게 된다. 이렇게 template DNA에 complementary sequence인 염기를 연결하면서 elongation이 진행된다. 마지막으로는 최종적으로 생성된 RNA ... protein에서 DNA로 정보가 흐르는 역방향은 일어나지 않는다고 전제한다. 하지만 현재 많은 생물학적 발견에 의해 과거의 이론들이 수정되면서 central dogma에도 오류
    Non-Ai HUMAN
    | 방송통신대 | 7페이지 | 4,300원 | 등록일 2021.07.20
    장바구니 다운로드
  • 자료 표지
    Example of Biopolymers - Proteins, DNA, Polysaccharides
    types of RNA molecules show extensive intramolecular base pairing between complementary sequences ... hort areas of complementary base pairing within the molecule, forming a three-dimensional structure ... 1. ProteinProteins are large, complex molecules that play many critical roles in the body. They do
    Non-Ai HUMAN
    | 리포트 | 19페이지 | 1,000원 | 등록일 2021.06.16 | 수정일 2021.06.18
    장바구니 다운로드
  • 판매자 표지 자료 표지
    [보건환경미생물학실험]Polymerase Chain Reaction(PCR) to amplify genes
    으로 다시 넎는 번거로움이 없으며, 30cycle이 가능하다. 하지만 proof-reading이 없어서 error율이 높다. error는 TA 배열을 cloning 후에 끝에 A ... 고, 5′-sequence의 primer1의 반대편에 위치할 primer2는 complementary reverse로 읽는다. (R)를 5′의 말단부를 primer로 읽지 않는 이유는 상보적인 DNA도 함께 증폭하기 위함이다. ... 보다 많은 양의 DNA를 생산해 내도록 한다.2. 실험 이론 및 원리가. concentration of primer : primer의 농도는 primer1과 primer2 각각 1
    Non-Ai HUMAN
    | 리포트 | 4페이지 | 1,500원 | 등록일 2022.10.10
    장바구니 다운로드
  • 자료 표지
    건국대학교 핵산생화학 중간고사 족보
    )GCGCAATATTTCTCAAAATATTGCGC(3). Write the base sequence of the complementary strand. What special ... total mass that is nucleic acid; and a factor, F, that corrects the A280 reading and gives a more ... type of sequence is contained in this DNA segment? Does the double-stranded DNA have the potential to
    시험자료 | 11페이지 | 3,000원 | 등록일 2024.06.26
    장바구니 다운로드
  • 자료 표지
    biosensor에 대한 발표 자료 입니다.
    between the target analyte and the complementary biorecognition layer produces a physico-chemical change ... biological to electrical signal where its amplification is necessary and takes place and read out in
    Non-Ai HUMAN
    | 리포트 | 12페이지 | 1,500원 | 등록일 2019.10.20
    장바구니 다운로드
  • 자료 표지
    제대로번역한 Reading for Today4 Concepts Chap 6. Traditional Medicine, A Non-Western Approach to Healing
    에 대한 비서구적 접근 In the twenty-first century, many people rely on what is referred to as Western ... medicine to heal injuries and illnesses. Western medicine is based on a scientific approach to healing. 21 ... 세기에, 많은 사람들은 부상과 질병을 치료하기 위해 서양의학이라 불리는 것에 의존한다. 서양의학은 치료에 대한 과학적 접근에 기반을 두고 있다. However, many c
    Non-Ai HUMAN
    | 리포트 | 8페이지 | 3,500원 | 등록일 2021.02.10 | 수정일 2021.02.15
    장바구니 다운로드
  • 판매자 표지 자료 표지
    [A+영어영작, 에세이] 전자책과 종이책의 발전, 각 장점과 단점, 전망, 나의 의견
    really reading a book. I think this is probably because the concept of 'books' has been influenced ... know there was an e-book. I learned the convenience of e-books after I read e-books by recommendation ... predictable. Personally, I think e-books and paper books have complementary aspects to each other. It's
    Non-Ai HUMAN
    | 리포트 | 3페이지 | 1,000원 | 등록일 2020.06.10
    장바구니 다운로드
  • 자료 표지
    Transformational Grammar 챕터 9, 10 요약
    (or case-marked) is ill-formed- PRO and overt lexical NP are in complementary distribution (cf. 66a-d ... Summary of Chapters 9 to 10 of Radford (1981)9. Filters- While constraints are conditions on ... derivations, filters are devices to scan the surface structures produced by the grammar1) INTERNAL CLAUSE
    Non-Ai HUMAN
    | 리포트 | 7페이지 | 2,000원 | 등록일 2020.12.30
    장바구니 다운로드
  • 자료 표지
    영어말히기대회 원고-베스트프렌드(입상유력)
    .We are similar, although we are complementary.우린 비슷하지만, 상호보완을 하는 거죠.-보통 여기서 친구 얘기를 더 하고 친구가족이야기 ... is very similar to me. We are both very complimental people나는 내 베프랑 비슷해요, 우리는 서로 칭찬하는 사이에요.입니다.그런데 ... time, he(she) can be very cold where I am very caring.그런데 동시에, 걔는 좀 냉정해요 저는 좀 배려를 잘하고,- 이건 반대로 이야기
    Non-Ai HUMAN
    | 리포트 | 2페이지 | 1,000원 | 등록일 2019.07.02 | 수정일 2019.07.03
    장바구니 다운로드
  • 자료 표지
    dna rna structure report
    themselves and make a secondary structure by forming hydrogen bonds between complementary base pairs ... end and 5 prime end. The B-DNA, which is the most common, rotates counterclockwise based on the ... one rotation. In B-DNA, which is the most common double helix structure found in nature, the double
    Non-Ai HUMAN
    | 리포트 | 2페이지 | 1,000원 | 등록일 2019.06.19
    장바구니 다운로드
  • 자료 표지
    구조역학 처짐실험 보고서
    물이 더 많다.1) 가상일 혹은 상보가상일 방법 (virtual work or complementary virtual work method)가상일의 원리는 하중평형을 만족 ... 의 r6(a LEQ x LEQ L)이다. 위의 방정식에서 집중하중을 받는 단순보의 처짐을 구할 수 있다.또, 적분 상수C _1 , ``C_2를 대입하여 정리하면 다음과 같다.E`I ... 최대처짐량이 발생하는 x ={L} over {2}지점에서의 처짐량은 이다.(2) 에너지 방법▷가상일의 방법 (단위하중법)여기서는 에너지보존의 법칙(principle of c
    Non-Ai HUMAN
    | 리포트 | 21페이지 | 1,500원 | 등록일 2018.07.28 | 수정일 2020.04.10
    장바구니 다운로드
  • 자료 표지
    기능유전체학 기말 범위 요점정리 (functional genomic)
    refpartially complementary 한것이 weak bind 가능 (cross hybridization)Fold change: probe intensity on A ... hotgun sequencingPrinciplepurposeto measure gene expression level – cnt reads that map to coding s ... by Read per kilobase of transcript per million mapped readsMapping:Mapping of reads to genome scale
    Non-Ai HUMAN
    | 시험자료 | 5페이지 | 2,000원 | 등록일 2017.07.20
    장바구니 다운로드
  • 자료 표지
    영어교수법 keyword
    omplementary 상보적으로 negotiate)NA? The Acquisition / Learning Hypothesisunconscious process / conscious rules ... instruction(implicit)특징grammar is taught deductivelynot fluent in Eng. can teach Eng.특징grammar is taught ... inductivelydialogue=means, grammar=goalCLT에 비해 teacher-centeredstudent can't control their outputCLT
    Non-Ai HUMAN
    | 리포트 | 3페이지 | 1,000원 | 등록일 2014.12.20
    장바구니 다운로드
  • 자료 표지
    PELT Chapter10 Content–based instruction
    ontent area, or carrier topic ... [along with] a complementary focus on L2 learning and teaching” ... Chapter 10. Content?based instructionCBI refers to the teaching of language through exposure to c ... ontent that is interesting and relevant to learners.1. What is content-based instruction?① Writing
    Non-Ai HUMAN
    | 리포트 | 5페이지 | 2,000원 | 등록일 2014.07.04
    장바구니 다운로드
  • 자료 표지
    생화학 핵산의 구조
    groectrophoresis* read sequence from bottom of gel to top* convert to the complementary sequence* c ... ): DNA polymerase 복제관여효소- copy each strand in complementary fashion- add nucleotides in 5′→3′ direction ... electrophoresis 전기영동(1) chain termination method (dideoxy method): 현재 사용하는 방법, human chromosome 서열
    Non-Ai HUMAN
    | 리포트 | 6페이지 | 1,500원 | 등록일 2014.05.25 | 수정일 2014.10.27
    장바구니 다운로드
  • 자료 표지
    영어교수법 ppt
    provided through reading a book, listening to a conversation, watching a movie. - Intake is a s ... and output are necessary processes and shows vary degrees of complementary distribution. Optimal ... Explicit and Implicit Learning Explicit learning ( = Intentional learning ) - Learning with conscious
    Non-Ai HUMAN
    | 리포트 | 16페이지 | 1,000원 | 등록일 2014.04.30
    장바구니 다운로드
  • 자료 표지
    언어습득론 자료 정리
    meaningful purposes3. Fluency and accuracy are seen as complementary principles4. To use the lang ... 고 있는 특징들이 바람의 방향이 바뀌는 것처럼 바뀌며 사막 같은 곳을 보면 없었던 모래언덕이 생겨나고 있었던 모래언덕이 없어진다.A glance through the past c ... -old nephew had gone through the stage of child language acquisition and become chatterbox of French
    Non-Ai HUMAN
    | 시험자료 | 22페이지 | 2,500원 | 등록일 2016.01.03
    장바구니 다운로드
  • 자료 표지
    PCR증폭
    는 target DNA단편을 가리키는 용어, 세포내의 chromosomal DNA나 complementary DNA (cDNA), plasmid DNA등을 사용할 수 있음② 가능 ... ) Probe 생산(증폭)- DNA hybrid를 위해 cloning된 이중가닥 DNA의 증폭3) Cloning- mRNA 로부터 특정 cDNA 및 vector에 삽입된 유전자 증폭4 ... (hy고려하여 합성해야 한다. 일반적으로 GC content가 50%가 되는 primer쌍을 이용하는 것이 바람직한데, 만약 annealing 온도를 높이면 primer-주형 DNA
    Non-Ai HUMAN
    | 리포트 | 10페이지 | 1,000원 | 등록일 2014.03.12
    장바구니 다운로드
  • 자료 표지
    PCR증폭
    나 complementary DNA (cDNA), plasmid DNA등을 사용할 수 있음② 가능한 순수하게 정제하는 것이 중요하며 양이 적을 때 반응이 충분히 일어나지 않고 양 ... (증폭)- DNA hybrid를 위해 cloning된 이중가닥 DNA의 증폭3) Cloning- mRNA 로부터 특정 cDNA 및 vector에 삽입된 유전자 증폭4) 돌연변이 ... Chain Reaction)과정 >03. PCR반응에 대해 고려할 점(1) Taq DNA 중합효소PCR에서 사용되는 polymerase는 Taq DNA 중합효소이다. 초기에는 E. c
    Non-Ai HUMAN
    | 리포트 | 10페이지 | 1,000원 | 등록일 2014.03.12
    장바구니 다운로드
해캠 AI 챗봇과 대화하기
챗봇으로 간편하게 상담해보세요.
2026년 03월 25일 수요일
AI 챗봇
안녕하세요. 해피캠퍼스 AI 챗봇입니다. 무엇이 궁금하신가요?
6:06 오전
문서 초안을 생성해주는 EasyAI
안녕하세요 해피캠퍼스의 20년의 운영 노하우를 이용하여 당신만의 초안을 만들어주는 EasyAI 입니다.
저는 아래와 같이 작업을 도와드립니다.
- 주제만 입력하면 AI가 방대한 정보를 재가공하여, 최적의 목차와 내용을 자동으로 만들어 드립니다.
- 장문의 콘텐츠를 쉽고 빠르게 작성해 드립니다.
- 스토어에서 무료 이용권를 계정별로 1회 발급 받을 수 있습니다. 지금 바로 체험해 보세요!
이런 주제들을 입력해 보세요.
- 유아에게 적합한 문학작품의 기준과 특성
- 한국인의 가치관 중에서 정신적 가치관을 이루는 것들을 문화적 문법으로 정리하고, 현대한국사회에서 일어나는 사건과 사고를 비교하여 자신의 의견으로 기술하세요
- 작별인사 독후감
“EasyAI 가 작성한 문서 초안은 완벽하지 않을 수 있습니다"
EasyAI 이동하기