"Protein sequence-structure correlation"의 검색결과 입니다.

기간
- 전체
- 3개월
- 6개월
- 1년
- 2년
- 3년
- 5년
직접입력

적용
연관순
- 연관순
- 최신순
영역
- 전체
- 제목
- 본문
- 태그
페이지 수
- 전체페이지
- 1 페이지 ~ 5 페이지
- 6 페이지 ~ 10 페이지
- 직접입력 페이지 ~ 페이지 적용
확장자
- 전체
- 한글
- PDF
- MS워드
- MS엑셀
- MS파워포인트
- 압축파일
- 기타
할인자료 보기

연관검색어

central dogma 실험 단백질검출 생물정보학 CRISPR 유전공학의 이해 닌하이드린 반응 분자세포생물학 세포생물학 정리 antibody drug immunostaining

AI 글쓰기

'Protein sequence-structure correlation' 초안, 3분이면 완성

AI가 맞춤 레포트 초안을 작성해 드립니다.

지금 시작하기 →

판매자 표지는 다운로드시 포함되지 않습니다.

"Protein sequence-structure correlation" 검색결과 1-20 / 2,259건

유니스트 UNIST 인공지능대학원 박사 자기소개서 연구계획서

Embodied AI.” This project will examine how causal structures can be embedded into transformer-based ... orrelation and causation, between black-box performance and transparent intelligence. My mission is ... , CausalBERT, and Structure Learning Transformers to solidify my understanding of structure-inducing learning

자기소개서 | 4페이지 | 3,900원 (20%↓) 3120원 | 등록일 2025.06.14

장바구니 다운로드
판매자 표지

칭화대학교 재료공학과 석사(IMP-MSE) 합격 자소서

required determination and persistence. Through persistent self-study and consistent review of core c ... oncepts, I built a firm foundation and developed a self-directed learning approach that continues to guide ... devices at my university laboratory, with a focus on nanowire-based structures. Through this work I

Non-Ai HUMAN
| 자기소개서 | 3페이지 | 8,000원 | 등록일 2026.01.06 | 수정일 2026.01.15

장바구니 다운로드
판매자 표지

[시험정리노트] 의약공정공학 졸업시험

gene has been deleted ( 3) Knock out animal study )20. correlating specific gene DNA sequence ... equence comparison ~ ( 2) sequnce homology studies )18. if two separate polypeptide found in one ... with different amino acid sequence ( 6) combinatorial peptide library )22. fate of a drug in the body

Non-Ai HUMAN
| 리포트 | 5페이지 | 1,000원 | 등록일 2025.11.13

장바구니 다운로드
판매자 표지

서강대 현대생물학실험2 site directed mutagenesis와 DNA sequencing

equence에서의 ORF protein sequence를 의미한다. 마지막 -는 종결 코돈을 나타낸다.Figure 14. Nucleotide BLAST cloning vector ... 한다.본 실험에서 사용하는 competent cell은 BL21로 modified Escherichia coli B strain이다. High-level protein ... 이 지정하는 protein sequence ORF가 지정할 수 있는 모든 경우의 수가 있다. 그중 빨간 네모로 표시한 것이 실험자가 선택한 cloning vector의 DNA s

리포트 | 17페이지 | 3,000원 | 등록일 2024.12.31

장바구니 다운로드
판매자 표지

생화학 5단원 단백질의 정제 요약정리

의 amino acid sequence는 protein의 tertiary structure 즉 전체 구조를 결정할 것이고 이 구조가 상호작용하여 quetenary structure을 만든 ... 는다. 각 fraction들에서 salting out이다 dialysis같은 여러 방법을 통해 protein 혼합물을 세분화 하여 얻는다. 그리고 gel-filtration c ... 다. 즉 polypeptide의 sequence가 전체 구조를 결정하는 것이고 protein의 고유한 구조는 protein의 기능을 결정한다. 따라서 이들 간의 관계는 매우 중요

리포트 | 2페이지 | 1,500원 | 등록일 2023.02.11

장바구니 다운로드
판매자 표지

고려대학교 일반대학원 화공생명공학과 연구계획서

에서 세포내 마크로라이드의 농축을 통한 세포기반 바이오센서의 민감도 향상 연구, Escherichia coli에서 methionine-methyltransferase를 이용한 S ... 의 protein V untranslated region sequence 최적화 연구, 폐암 및 당뇨병의 잠재적인 모니터링을 위한 쥐 냄새에 의한 다중 냄새 식별 연구, 폐암의 잠재적 스 ... Streptomyces 게놈에 암호화된 이차 대사산물 생합성 유전자 클러스터를 규명하는 연구, Origami용 single-stranded DNA 생산 증가를 위한 M13 phage

자기소개서 | 2페이지 | 3,000원 | 등록일 2023.04.17

장바구니 다운로드
central dogma

), orange (5S rRNA), and green (16S rRNA)Complex structure of RNA Protein-rRNA complexes of the large ... ; the mRNA 5’ end encodes the N-terminus of the protein 1. Translation begins at AUG, ends at stop codon ... (UAG, UAA, UGA) 3. Prokaryotes : initiation near Shine-Dalgarno sequence Eukaryotes : ribosome sc

Non-Ai HUMAN
| 리포트 | 30페이지 | 2,000원 | 등록일 2022.02.21

장바구니 다운로드
단백질 서열과 이차 구조의 상호 정보 분석 (Analysis of Mutual Information Between a Protein Sequence and a Secondary Structure)

한국물리학회 이주련

논문 | 7페이지 | 무료 | 등록일 2025.07.04 | 수정일 2025.07.10

다운로드
동물유전과개량 ) Central dogma에 대해 기술하고, DNA, RNA, 단백질 각각의 분석 방법에 대하여 기술하시오

, nucleotide sequence가 ACA인 DNA를 template로 하는 경우, transcription 되는 mRNA는 UGU라는 complementary sequence를 가지 ... 게 된다. 이렇게 template DNA에 complementary sequence인 염기를 연결하면서 elongation이 진행된다. 마지막으로는 최종적으로 생성된 RNA ... 는 protein을 합성할 때만 결합하고 이외에는 분리된 구조이다.2. DNA 분석 방법DNA 분석 방법은 DNA의 nucleotide sequence를 결정하는 방법이기 때문에 DNA s

Non-Ai HUMAN
| 방송통신대 | 7페이지 | 4,300원 (70%↓) 1290원 | 등록일 2021.07.20

장바구니 다운로드
2025 삼성전자 메모리공정기술 [영문본 합격] 자기소개서와 면접자료

(Reactive Ion Etching) lag and micro-loading effects. By correlating simulation data with actual SEM ... "Technical Integrity based on Data" is the most vital quality. In a massive-scale fab, many physical ... phenomena are invisible and complex, often leading to misleading surface-level symptoms. An engineer

자기소개서 | 6페이지 | 3,000원 | 등록일 2026.03.26

장바구니 다운로드
Ch2. The Structure and Functions of Biological Molecules

protein function.Secondary structure refers to the conformation of adjacent amino acids into a ... structural and functional molecules in cells.Include four major categories : proteins, nucleic acids ... Structure of ProteinsPrimary structure, the sequence of amino acids in the polymer, is critical to the

시험자료 | 3페이지 | 1,500원 | 등록일 2025.02.21

장바구니 다운로드
비선형수열의 상호상관함수 분석 (Analysis of cross-correlation functions of non-linear sequences)

한국정보통신학회 조성진, 임지미

논문 | 7페이지 | 무료 | 등록일 2025.05.16 | 수정일 2025.05.22

다운로드
판매자 표지

유전자치료공학 관련 2차 정리본입니다.

transfer vector (Lentiviral plasmid)- Viral protein coding sequence를 제거한 후에, Reporter gene 또는 ... 떼, 5’LTR-Gag-Pol-Env-LTR3’으로 구성- Gag (Virion structural protein, protease) / Pol(Reverse ... ) synthesis of enzymatic and structural viral protein vector (Packaging Plasmid)- Viral particle을 형성

시험자료 | 15페이지 | 3,000원 | 등록일 2023.06.23 | 수정일 2023.06.28

장바구니 다운로드
건국대학교 핵산생화학 중간고사 족보

type of sequence is contained in this DNA segment? Does the double-stranded DNA have the potential to ... Nucleic Acid Biochemistry -Midterm Exam- 1. One strand of a double-helical DNA has the sequence (5 ... )GCGCAATATTTCTCAAAATATTGCGC(3). Write the base sequence of the complementary strand. What special

시험자료 | 11페이지 | 3,000원 | 등록일 2024.06.26

장바구니 다운로드
[생체의용고분자] REVIEW 논문 PPT 간단 정리 (영문)

) Repeating-sequence PLGA copolymers - Catalysts : 1,3 diispropylcarbodiimide (DIC) and 4 ... - aspatic acid (RGD) was the minimal cell-recognizable sequence in many extracellular matrix protein and ... tabilization of spinal segments, maxillofacial, craniofacial, orthopaedic , etc ▪ Scaffolds - The s

Non-Ai HUMAN
| 리포트 | 52페이지 | 3,000원 | 등록일 2021.12.21 | 수정일 2021.12.23

장바구니 다운로드
판매자 표지

part.2 성균관대 신소재공학 대학원 전공 면접 (2/4)

+ BCC reciprocal latticeFCC, BCC, HCP구조 그림 그리기조밀면 (closed-packed plane), 위치 표시Stacking sequence/최조밀면/더 ... 립의 크기를 줄이는 법Stress-strain curveElastic modulus 정의Toughness 정의금속과 반도체에서 성질이 다 같을 때 구별 방법BaTiO3 구조양자 ... 단단한 것/슬립면 개수FCC와 HCP의 구조적 차이, stacking 관점에서의 차이HCP structure(0011), [0011], {0011}, 구분Miller

자기소개서 | 4페이지 | 8,000원 | 등록일 2023.05.03 | 수정일 2026.04.16

장바구니 다운로드
인공지능 대학원 전공 면접 준비자료(약 150문항)

은 GPU와 같은 더 큰 컴퓨팅 자원이 필요- The choice between ML and DL depends on several factors, such as Task ... Complexity, Data, and Hardware Resources.- ML is a good choice for simple classification or regression ... 횟수가 필요하지만 계산 비용이 훨씬 저렴- Gradient descent may get stuck in local minima when optimizing non-convex

자기소개서 | 26페이지 | 20,000원 | 등록일 2024.01.01 | 수정일 2024.01.03

장바구니 다운로드
Example of Biopolymers - Proteins, DNA, Polysaccharides

-Secondary-Tertiary-Quaternary structure of protein](3) Tertiary structure:This level of structure ... ('TZ')" thymine, and their structures are shown below.[Fig.8. Four types of N-containing bases in DNA ... within the RNA strand, creating a predictable three-dimensional structure essential for their function

Non-Ai HUMAN
| 리포트 | 19페이지 | 1,000원 | 등록일 2021.06.16 | 수정일 2021.06.18

장바구니 다운로드
판매자 표지

서울대학교 생화학실험 - Protein Expression & Purification (실험2) 결과레포트

이 denaturation되어 structure는 의미가 없어지고, amino acid 하나당 SDS 하나가 protein에 붙어 아주 큰 negative charge가 주어져 native c ... .Coli에서 발현한 후, 이를 Histag + Ni-NTA resin을 이용한 column chromatography로 정제하였다. 정제된 sample 중 elution에 해당 ... operon의 structural gene 자리에 들어가 있다. Lac operon은 negative, inducible system으로, 평소엔 repressor가 작용하지만 allo

Non-Ai HUMAN
| 리포트 | 8페이지 | 2,500원 | 등록일 2022.12.10

장바구니 다운로드
확장 Zeng 수열의 상호상관 함숫값에 대한 연구 (A study on the cross-correlation function of extended Zeng sequences)

한국전자통신학회 김한두, 조성진, 권민정, 안현주

논문 | 7페이지 | 무료 | 등록일 2025.03.12 | 수정일 2025.03.28

다운로드

이전10개12 3 4 5 6 7 8 9 10 다음10개

파워링크

신청하기