• LF몰 이벤트
  • 파일시티 이벤트
  • 서울좀비 이벤트
  • 탑툰 이벤트
  • 닥터피엘 이벤트
  • 아이템베이 이벤트
  • 아이템매니아 이벤트
  • 통합검색(16,032)
  • 리포트(14,241)
  • 시험자료(1,008)
  • 방송통신대(417)
  • 자기소개서(305)
  • 논문(40)
  • 서식(11)
  • ppt테마(6)
  • 표지/속지(2)
  • 노하우(2)

"DNA구조" 검색결과 1-20 / 16,032건

  • DNA 구조의 이해
    생물학실험 보고서DNA 구조의 이해실험목적이번 실험의 목적은 적혈구의 용혈 현상을 통하여 삼투와 전해질, 비전해질에 대하여 이해해보고자 한다. ... DNA는 전체적으로 음전하는 띠는 분자여서 붉은색을 띠고 있는 양이온이 염색체에 끌려가게 되어 염색체를 염색된 것처럼 보이게 한다.실험결과 삼투압=0.3*0.0821*T*1
    리포트 | 8페이지 | 1,000원 | 등록일 2022.04.10
  • DNA virus 구조와 특징
    the growing DNA chain, which elongated in the 5’3’ direction• Each parental strand of a duplex DNA ... is catalyzed by DNA-dependent DNA polymerases, but many accessory proteins are required for initiation ... DNA is always synthesized by template-directed, stepwise incorporation of dNMPs into the 3’-OH end of
    시험자료 | 30페이지 | 5,000원 | 등록일 2023.04.08
  • DNA 구조의 이해와 DNA 추출
    리포트 | 9페이지 | 1,000원 | 등록일 2020.05.07
  • DNA 구조의 이해 & DNA 추출
    실험 제목 : DNA 구조의 이해 & DNA 추출실험 목적생물체의 유전정보를 가지고 있는 DNA는 디옥시리보뉴클레오티드로 이루어진 고분자 중합체이다.DNA 단일가닥 또는 이중가닥의 ... 왓슨과 크릭이 DNA 이중나선의 구조를 밝힘으로써 샤가프의 법칙도 자연스럽게 이해될 수 있었다. ... 방법의 원리를 배우고, DNA의 이화학적 특성을 이해한다.실험 원리DNA 염기의 구조 (출처: 남석현 외, 일반생물학실험, 범문에듀케이션, 2012, p.111)세포의 유전정보를
    리포트 | 9페이지 | 1,500원 | 등록일 2023.07.20
  • DNA 구조 모형 제작
    DNA의 정확한 구조는 염기쌍에 따라 달라지기 때문에 완벽하게 DNA가 규칙적이지 않다. ... , B-DNA, Z-DNA가 있다. ... 또한 DNA는 유전정보를 전달하기 때문에 DNA의 축적된 생물의 진화를 관찰할 수 있는 유적이다.
    리포트 | 7페이지 | 2,500원 | 등록일 2024.03.28
  • 13. DNA구조의 이해
    본 실험에서는 이중가닥 DNA구조를 직접 조립하는 과정을 통하여 DNA의 정확한 구조를 이해한다.3. ... 고찰이번 실험은 주어진 DNA 모형 kit를 이용해 이중가닥 DNA구조를 직접 조립하는 과정을 통해 DNA의 정확한 구조를 이해하는 것이 목적이었다.DNA 구조를 이루는 인산기, ... 분포는 DNA가 나선형 구조를 갖는다는 것을 의미한다고 해석했다.
    리포트 | 4페이지 | 1,000원 | 등록일 2022.06.29
  • DNA구조와 유전자 발현
    제9장 DNA구조와 유전자 발현1. DNA복제가 시작되는 곳으로 DNA이중나선의 벌어진 부분을 무엇이라 하는가?복제원점2. ... 오페론의 구조와 기능에 대하여 설명하라.기능- 세균에서 유전자 발현을 조절한다.구조- 젖당이 없을 때 프로모터 앞에 억제유전자가 작동이되어 MRNA가 만들어지고 이 MRNA가 리보솜에 ... DNA복제방법에 대하여 설명하라.각 사슬을 주형으로 상보적인 DNA를 합성하고 결합 단백질이 풀어진 단일 가닥의 재결합을 막는다.프리마제가 주형 DNA와 상보적인 RNA 프라이머를
    시험자료 | 2페이지 | 5,000원 | 등록일 2023.07.04
  • DNA/RNA 구조의 이해
    DNA와 구별되는 점은 우선 티민 대신 우라실로 구성되어 있으며 무엇보다 DNA의 한 가닥을 떼어 놓은 구조라는 것이다. ... 실험제목과 날짜DNA/RNA 구조의 이해 및 모형 제작실험일: 2019-03-182. ... DNA가 이중나선 구조를 가지는 이유는 우선 DNA내에 있는 물질 (당, 인산, 염기) 사이에 화학 결합이 존재하기 때문이라고 생각한다.
    리포트 | 4페이지 | 1,000원 | 등록일 2020.09.09 | 수정일 2020.10.13
  • DNA RNA 구조의 이해
    DNA RNA 구조의 이해2019/09/24실험 목적DNA 이중 나선 구조 모형을 확인하고, RNA 단일 가닥 2차 구조를 수치적 측정을 통해 확인 후 모형 제작하기ResultDiscussion유전 ... 물질인 DNA가 어떻게 이중 나선 구조이며 왜 뒤틀리는가? ... 체내 이중 나선 DNA구조는 한가지 형태만 있을까?그렇지 않다. 3가지(A형, B형, Z형)의 DNA 구조가 우리 체내에 있는데 각각이 모두 차이를 보인다고 한다.
    리포트 | 4페이지 | 1,000원 | 등록일 2020.03.27
  • DNA, RNA 구조의 이해
    DNA구조에 대한 결정적인 정보는 X선 회절 실험에 의하여 얻어졌다. ... 이 외에도 부분적으로 탈수된 상태나 고농도의 염분 상태에서는 A형 DNA 구조가 존재한다. ... DNA & RNA 구조의 이해☪ 실험날짜: 2018.03.14☪ 2조:실험 목적⚩ We can confirm double helix structure of DNA by making
    리포트 | 4페이지 | 2,000원 | 등록일 2019.08.26 | 수정일 2021.01.16
  • DNA와RNA 구조 및 비교
    또, 평소 유전공학과 DNA 및 RNA의 구조에 관심이 많았기 때문에 DNA의 수소결합 및 구조와 RNA의 결합방식과 구조에 대해 탐구해보고 싶어졌다. ... 이러한 DNA의 화학적 구조는 RNA보다 열이나 산과 같은 외부 충격에 강한 구조를 가지게 된다. ... 염기는 소수성이 커서 두 가닥의 DNA 안쪽에 위치하며, 두 DNA 가닥은 2중 나선 구조를 이룬다.
    리포트 | 5페이지 | 2,000원 | 등록일 2022.05.13
  • DNA,RNA 구조의 이해 레포트
    체내의 이중 나선 DNA구조는 A-DNA, B-DNA, Z-DNA 로 세 종류가 알려져 있다. 이 중 우리 몸에서 가장 흔하게 찾아볼 수 있는 형태는 B-DNA 이다.4. ... DNA/RNA 구조의 이해2017년 3월 13일computational prediction 을 이용해 제시된 RNA 서열의 세포 내 2차 구조에 대하여 알아본다.① 5'- AGCCCAUUGCGAUGUACG ... -3'② 5'- AGCCCGCCUAAUGAGCGGGCU -3'RNA 2차 구조 예측 웹 프로그램에 RNA 서열을 넣으면 주어진 RNA 서열에 따른 세포 내에서의 RNA 2차 구조
    리포트 | 3페이지 | 1,000원 | 등록일 2020.02.06
  • DNA 구조의 이해 결과보고서
    염색체: 세포의 분열 시 핵 속에 나타나는 굵은 실타래나 막대모양 구조물로, 생명체의 DNA 및 히스톤 단백질이 응축되어 있는 구조를 말한다. ... 뉴클레오솜: 진핵세포 DNA 패키징의 가장 기본적인 단위로서 DNA 와 히스톤으로 구성되어 있다. 2. ... DNA: 자연에 존재하는 2 종류의 핵산 중에서 디옥시리보오스를 가지고 있는 핵산으로, 유전자의 본체를 이룬다.
    리포트 | 5페이지 | 1,000원 | 등록일 2023.12.21
  • DNA 구조 모형 제작 발표 ppt
    때로 rRNA 나 tRNA 는 3 차구조나 2 차구조를 이루기도 한다 . ② DNA 와 RNA 의 차이 - 형태의 차이 ② DNA 와 RNA 의 차이 - 성질의 차이 DNA 는 자연적인 ... 실험 원리 구조적 특징 A-DNA B-DNA Z-DNA 나선 구조 방향 오른쪽 오른쪽 왼쪽 반복 단위 1 bp 1 bp 2 bp 회전 각도 32.7° 34.3° 60°/2 1 회전 ... DNA 구조 모형 제작01. 실험 목적 02. 실험 기구 및 재료 03. 실험 방법 04. 실험 원리 목차 05. 예상 결과 06. 출처01.
    리포트 | 22페이지 | 1,500원 | 등록일 2021.07.18 | 수정일 2021.07.21
  • DNA와 RNA의 구조 결과보고서
    RNA의 구조이해Date2020년 3월 30일Ⅱ 실험 목적ObjectiveDNA 이중나선구조와 RNA외가닥 2차구조를 이론적으로 배우고 모형으로 만들며 그 차이를 이해한다.DNA와 ... /entry/12-DNA%EC%9D%98-%EA%B5%AC%EC%A1%B0-3" https://stementor.tistory.com/entry/12-DNA의-구조-3캠벨 생명과학 ... Bae hyeon sookBIO1008-03Date: March 30,2020일반생물학및실험(1) 심화결과보고서1주차 DNA와 RNA의 구조이해Ⅰ 실험제목과 실험날짜TitleDNA
    리포트 | 3페이지 | 1,000원 | 등록일 2020.04.14
  • 일반생물(1)_DNA와 RNA 구조의 이해
    DNA와 RNA 구조의 이해1. ... 웟슨과 크릭은 주로 DNA 구조에 대한 X-선 회절 사진에 나타난 자료를 근거로 DNA의 이중나선 구조를 규명하였다. ... 이중나선 구조에 대한 이해가 중요하다.DNA 이중나선 구조의 기본 구조는 뉴클레오티드(nucleotide)라고 부르는 단위체이다.
    리포트 | 4페이지 | 1,000원 | 등록일 2023.06.22
  • 생물학 실험-DNA 구조의 이해
    이중 나선 구조DNA가 생리적 조건에서 취하는 일반적인 형태는 이중나선 모형이다. 왓슨-크릭의 이중나선 모형을 B-DNA 형태라 부르기도 한다. ... DNA 구조와 기능 / file:///C:/Users/user/Downloads/7-1.pdf/21.06.01 ... 동시대의 과학자 프랭클린의 연구를 통해 인산-당 골격이 DNA 이중 나선 구조의 바깥 부분에 위치한다는 것을 알았다.
    리포트 | 5페이지 | 1,000원 | 등록일 2022.07.08
  • [일반생물학실험]DNA 구조의 이해
    본 실험에서는 이중가닥 DNA구조를 직접 조립하는 과정을 통하여 DNA의 정확한 구조를 이해한다.2. 실험 원리 및 이론가. ... DNA구조1) 핵산핵산은 살아 있는 세포의 유전 물질을 구성하는 물질로DNA와 RNA가 속한다. ... 염색체 구조DNA는 두 가닥의 폴리뉴클레오타이드 사슬이 서로 마주보고 나선 모양을 꼬여 이중나선 구조를 이루며, 히스톤 단백질을 휘감아 뉴클레오솜을 형성한다.뉴클레오솜은 DNA에 의해
    리포트 | 4페이지 | 1,500원 | 등록일 2021.10.03
  • 아주대 생명과학실험 DNA구조의 이해
    DNA의 이중 나선 구조에서는 두 가닥이 서로 반대 방향인 역평행 구조를 가진다. ... 통하여 DNA의 정확한 구조를 이해한다.02. ... 실험제목 :DNA 구조의 이해01. 실험목적* 생물체의 유전정보를 가지고 있는 DNA는 디옥시리보뉴클레오티드로 이루어진 고분자 중합체이다.
    리포트 | 7페이지 | 1,500원 | 등록일 2024.04.15
  • A+/ DNA 구조 모형 만들기 예비레포트
    모형을 발표하고 DNA가 이중 나선 구조라는 것을 밝혔다.2) DNA의 이중 나선 구조: DNA는 두 가닥의 폴리뉴클레오가 마주 보며 꼬여 있는 이중 나선 구조이며, 당과 인산은 이중 ... DNA 입체 구조1) DNA의 입체 구조를 밝히기까지의 연구과정샤가프의 법칙1950년 샤가프는 생물종에 따라 DNA를 구성하는 각 염기의 조성은 다르지만, 한 종의 DNA에서는 항상 ... 당-인산 골격이 나선 구조의 바깥쪽에 있다는 것을 알아냈다.왓슨과 크릭의 DNA 모형1953년 왓슨과 크릭은 샤가프의 법칙과 DNA의 X선 회절 사진을 토대로 DNA의 입체 구조
    리포트 | 3페이지 | 1,500원 | 등록일 2022.09.04
  • 레이어 팝업
  • 프레시홍 - 특가
  • 프레시홍 - 특가
  • 레이어 팝업
  • 레이어 팝업
  • 레이어 팝업
AI 챗봇
2024년 07월 19일 금요일
AI 챗봇
안녕하세요. 해피캠퍼스 AI 챗봇입니다. 무엇이 궁금하신가요?
6:40 오전
New

24시간 응대가능한
AI 챗봇이 런칭되었습니다. 닫기