"catalytic activity sequence"의 검색결과 입니다.

기간
- 전체
- 3개월
- 6개월
- 1년
- 2년
- 3년
- 5년
직접입력

적용
연관순
- 연관순
- 최신순
영역
- 전체
- 제목
- 본문
- 태그
페이지 수
- 전체페이지
- 1 페이지 ~ 5 페이지
- 6 페이지 ~ 10 페이지
- 직접입력 페이지 ~ 페이지 적용
확장자
- 전체
- 한글
- PDF
- MS워드
- MS엑셀
- MS파워포인트
- 압축파일
- 기타
할인자료 보기

연관검색어

SNOW ANN BEATTIE 분자생물학 중간 효소 정리 Enzyme activity immunology HNPCC RT-PCR 고찰 aptamers

판매자 표지는 다운로드시 포함되지 않습니다.

"catalytic activity sequence" 검색결과 1-20 / 31건

colorectal carcinogenesis

는adenomatous polyposis coli (APC) 의 mutations 의 획득으로 시작하여 oncogene KRAS 의 mutational activation 과 tumor s ... 의 major players 이다.이 pathway 로 발생하는 tumor 는 coding sequences에서 상대적인 base pair mutation 의 부족 ... TP53 의 mutation KRAS 와phosphatidylinositol-4,5-bisphosphonate 3-kinase catalytic subunit alpha (PIK

리포트 | 4페이지 | 2,500원 | 등록일 2021.03.25

다운로드 장바구니
판매자 표지

생화학 13단원 생물체 내에서 효소의 작동 예시 요약정리

해야하지 자기 자신의 DNA를 파괴하면 안되므로 매우 큰 specificity를 가져야한다. 즉 recognition sequence를 가진 DNA (cognate DNA)만 절단 ... 하고 recognition sequence가 없는 DNA strand는 파괴하면 안된다. 가령 Escherichia coli가 가진 restriction endonuclease 중 하나 ... 인 EcoRV는 5`-GATATC-3`를 가진 viral DNA를 절단하지만 E. coli가 이런 서열을 매우 많이 가지고 있음에도 자기 자신의 genome DNA strand

리포트 | 2페이지 | 1,500원 | 등록일 2023.02.11

다운로드 장바구니
건국대학교 핵산생화학 중간고사 족보

)GCGCAATATTTCTCAAAATATTGCGC(3). Write the base sequence of the complementary strand. What special ... type of sequence is contained in this DNA segment? Does the double-stranded DNA have the potential to ... Nucleic Acid Biochemistry -Midterm Exam- 1. One strand of a double-helical DNA has the sequence (5

시험자료 | 11페이지 | 3,000원 | 등록일 2024.06.26

다운로드 장바구니
무전해 코발트계 석출막에 미치는 기판의 영향 (Effect of Substrate on Electroless Co-Base Deposited Films)

한국재료학회 한창석, 천창환, 한승오

논문 | 6페이지 | 무료 | 등록일 2025.03.18 | 수정일 2025.03.28

다운로드
약학 대학 모의 면접 문항

mRNA molecule, these two subunits split apart. Ribosomes are ribozymes, because the catalytic ... a remarkable degree, evidence of a common origin. They differ in their size, sequence, structure ... 2018학년도 약학대학 정시최종모의면접 문제수험번호 : 성명 :※ 다음 제시문을 읽고 물음에 답하시오생 물※ A ribosome is made from complexes of

자기소개서 | 2페이지 | 3,000원 | 등록일 2018.07.06

다운로드 장바구니
연세대학교 생물학입문 텀프로젝트 (단백질)

.htmChemical motifs of the triad in chemical structuresThe chymotrypisin is shaped like a sphere and consists ... of three polypeptide chains, which are connected by a disulfide bond. It is composed of a single ... polypeptide called chymotrypsinogen, which is activated by dividing the polypeptide into three chains

리포트 | 9페이지 | 1,000원 | 등록일 2018.11.07

다운로드 장바구니
분자세포생물학 핵심 요약

- some RNAs catalytic activity[RNA enzyme, Ribozyme]Sequencing nucleic acids· sanger procedure; DNA ... ? ElectrophoresisOther methods; nucleotide sequencing, X-ray crystallography, electron microscopyWaston and Crick ... · Polysaccharide = polymers of sugars or sugar derivatives· Nucleic acids? Gene cloning

시험자료 | 2페이지 | 1,500원 | 등록일 2016.05.12

다운로드 장바구니
Phosphoinositide 3-Kinase Signaling

activating Wnt target genes, which in turn regulate stem cells and tumorigenesis. Without Wnt: catenin is ... 110 catalytic subunit and a p85 regulatory subunit. There are five variants of the p85 regulatory s ... atalytic subunit designated p110α, β, or δ catalytic subunit. The first three regulatory subunits are all s

리포트 | 16페이지 | 1,000원 | 등록일 2012.04.24

다운로드 장바구니
무전해 코발트계 석출막에 미치는 기판의 영향

한국재료학회 한창석, 천창환, 한승오

논문 | 6페이지 | 4,000원 | 등록일 2016.04.02 | 수정일 2023.04.05

다운로드 장바구니
snow vs. happyending

is the snow, so it operates as a catalytic to arouse the memory. Then, as mentioned in “Even now, s ... impressive to her, thus she can recollect most of the minute events when she goes back to their previous ... house after the winter past and watches some crocus in front of the house resembling the snow flakes

리포트 | 3페이지 | 1,000원 | 등록일 2014.10.03

다운로드 장바구니
Transcription

proteibunit – catalytic center Their sequences ate related to those of the largest subunit of eukaryotic ... bubion The enzyme moves along the DNA and extends the growing RNA chain. Termination The sequence of ... promoter while positions -1 to -4 enter the active site.Fig.11. 8 The b(cyan) and b' subunit(pink) of

리포트 | 28페이지 | 1,000원 | 등록일 2012.04.24

다운로드 장바구니
판매자 표지

DNA부터단백질까지

activity. This supports the idea that catalytic RNA evolved before DNA.14.5 How Is RNA Translated ... , but do not scramble, the DNA sequence that encodes a polypeptide. Sometimes, the separated exons code ... activity—if rRNA is destroyed, the activity stops Therefore rRNA is the catalyst in peptidyl transferase

리포트 | 92페이지 | 3,800원 | 등록일 2012.05.24

다운로드 장바구니
원핵생물과 진핵생물의 전사과정 비교

subunit 모두 cloning → 일부 기능 알려짐{3} Eucaryotic 'core' subunit◇ RPB의 기능- RPB1, 2 : catalytic active ... :n initiation site 부위, consensus sequence : YAYTCYY- TATA box(Hogness box) : initiation site로부터 19 ... ∼27 base pairs upstream, prokaryotic Pribnow box와 유사, consensus sequence : TATAA(or T)A- Core promoter

리포트 | 12페이지 | 1,000원 | 등록일 2012.05.04

다운로드 장바구니
Taqman PCR

tranded DNA. sequence-specific DNA probes consisting of oligonucleotides that are labelled with a ... polymerase to cleave a dual-labeled probe during hybridization to the complementary target sequence and ... polymerase chain reaction. Real-time PCR is used to amplify and simultaneously quantify a targeted DNA

리포트 | 26페이지 | 1,000원 | 등록일 2011.06.28 | 수정일 2016.05.11

다운로드 장바구니
Artificial Enzyme

nature P roduce artificial enzymes Reproduce the enzyme’s function Mimics of enzymes High catalytic ... activity and stability Introduction 4Natural Enzyme VS. Artificial Enzyme Natural enzyme Artificial ... enzyme Temperature / Organic solvent Losing the activity easily Relatively stable Chemical structure

리포트 | 42페이지 | 4,000원 | 등록일 2011.05.09

다운로드 장바구니
Aptamer의 정의와 특징, 발전 구조, SELEX cycle전반적 내용

equences which best resist the selection pressure. (5) Aptamers are then cloned, sequenced and tested ... for binding or catalytic activity.Table 1. Post-SELEX modifications for in vivo applications[99mTc]In ... administration of PDGF receptor inhibitor in KAT-4 tumors grown subcutaneously in severe combined immune

리포트 | 66페이지 | 5,500원 | 등록일 2010.11.14

다운로드 장바구니
정상세포에 텔로머라제 도입을 통한 세포 수명 연장

의 telomerase-negative 정상세포 타임과, 망막 색소 상피 세포와 음경포피 섬유아세포가 사람의 텔로머라제 촉매소단위(catalytic subunit)를 가진 벡터로 전환 ... onstruct)로 전환시켰다. 첫번째 구성체는 전사적 효율성을 높이기 위해 hTRT 내 59와 39 비번역 부위를 제거하고 순서를 일치시키기위해(consensus sequence ... telomerase into normal human cells)텔로머라제 발현이 세포 수명을 증가시키는지 결정하기 위해 우리는 hTRT2 정상세포를 두개의 다른 hTRT 발현 구성체(c

리포트 | 7페이지 | 2,000원 | 등록일 2013.01.28

다운로드 장바구니
[생물학]【A+】미생물학

RNA synthesisThe sigma subunit (sigma factor) is not catalytic, but helps the core enzyme bind DNA at ... Cellular & Molecular Biology HYPERLINK "http://highered.mcgraw-hill.com/sites/0072320419/student ... - An IntroductionMicrobiology is the study of organisms too small to be clearly seen by the unaided eye

리포트 | 274페이지 | 1,000원 | 등록일 2011.06.19

다운로드 장바구니
DNA Replication - Detailed Mechanism

: p43 and p123 ( TERT, Telomerase Reverse Transcriptase)germ cells retain telomerase activity and c ... Replication in E. coliPriming at ori CDnaA binds to oriC at sites called dnaA boxes and HU protein induces ... fragment synthesis on lagging strandDnaB has a helicase activity that unwinds DNA as the replisome

리포트 | 4페이지 | 1,500원 | 등록일 2009.12.06

다운로드 장바구니
미생물의 유전, 세균 내 외부 유전자의 도입과 세포 내에서의 운명

identical to the template's original partner strand. DNA polymerases use a magnesium ion for catalytic ... - Bacteriophage lamda, Mu, Transposon..PAGE:4Homologous RecombinationBetween homologous DNA ie sequence is ... similarAt least one of the strands of each DNA duplex is brokenStrands exchange and cut ends are

리포트 | 37페이지 | 3,000원 | 등록일 2010.07.12

다운로드 장바구니

이전10개12 다음10개

파워링크

신청하기