• 통합검색(12,172)
  • 리포트(8,891)
  • 논문(2,424)
  • 시험자료(571)
  • 방송통신대(176)
  • 자기소개서(87)
  • 기업보고서(12)
  • 서식(5)
  • ppt테마(4)
  • 이력서(2)

바로가기

RNA 독후감 - RNA 관련 독후감 1건 제공

"RNA" 검색결과 1-20 / 12,172건

  • 한글파일 RNA extration
    2017.08.22 * RNA extraction(Isolation ... ) - RNA extraction 은 RNA를 조직이나 세포에서 추출하는 ... 방법으로 RNA를 뽑아 역전사를 통 해 cDNA를 합성하기 위해 시행하기도 ... 하며, RNA sequencing 뿐만 아니라 여러 screening ... 을 위해 하기 도 한다. 하지만 RNA는 DNA에 비해 안정적이지 않고
    리포트 | 4페이지 | 1,000원 | 등록일 2017.12.01
    다운로드 장바구니
  • 파워포인트파일 RNA PPT
    : 제출일 : CONTENTS Q A 05 비암호화 RNA 와 암호화 RNA ... 의 정의와 역사 02 작은 비암호화 RNA 정의와 긴 암호화 RNA ... 발견 03 RNA 세계 확장 배경 04 RNA 세계와 리보솜의 역할 01 ... 1. RNA 세계와 리보솜의 역할 1) 비암호화 RNA 와 암호화 RNA ... 의 정의 2. 비암호화 RNA 와 암호화 RNA 의 정의와 역사
    리포트 | 10페이지 | 2,000원 | 등록일 2020.10.12
    다운로드 장바구니
  • 워드파일 RNA extraction
    유전학 실험실습 결과 보고서 RNA extraction 과 목 명 ... 주인 Caco2 cell에서 RNA를 추출하여 전기영동을 통해 확인하여 ... 본다. RNA RNA 또는 Ribonucleic acid는 오탄 ... 만들어진다. RNA는 단백질을 합성하는 과정에 작용하며 일부 바이러스는 ... DNA 대산 RNA를 유전물질로 갖기도 한다. 핵염기로 DNA와 달리 티민
    리포트 | 7페이지 | 2,000원 | 등록일 2020.03.31
    다운로드 장바구니
  • 한글파일 RNA간섭
    차례 1. RNA Interference를 이용한 저니코틴 함량 담배 ... tabacum L.Using RNA Interference http ... 성에 대한 RNA silencing의 응용 (Application of ... RNA silencing to plant disease resistance ... ) -RNA 간섭 포함한 개념인데 비슷한 내용이라 넣어봤다능 https
    리포트 | 7페이지 | 2,500원 | 등록일 2018.02.04
    다운로드 장바구니
  • 워드파일 RNA isolation RT-PCR
    RNA isolation & RT-PCR 1) RNA isolation ... RNA pellet for 10 min - Resuspend the RNA ... Water - Incubate the RNA sample at 55°C for ... 10 min - Determine the RNA yield using ... nanodrop (260 nm/ 280 nm; RNA purity 1.8
    리포트 | 2페이지 | 500원 | 등록일 2019.06.26
    다운로드 장바구니
  • 한글파일 RNA Isolation (생명과학 실험)
    RNA Is olation 목차 Ⅰ. Introduction3 1 ... ) RNA의 구조3 2) RNA의 종류3 3) 시약의 원리3 Ⅱ ... . Discussion5 1) RNA sample이 오염되는 경우5 2) 추출하는 RNA ... 농도 높이는 방법5 3) RNA를 추출하는 이유6 Ⅴ. Reference ... 7 Ⅰ. Introduction 1) RNA의 구조 RNA의 기본단위는
    리포트 | 7페이지 | 700원 | 등록일 2020.09.26
    다운로드 장바구니
  • 파워포인트파일 DNA와 RNA
    DNA 와 RNA DNA 와 RNA 의 차이점을 알아보자 ! 목차 ... -DNA 란 ? -RNA 란 ? -DNA 와 RNA 의 관계와 차이 ... 점 - 전사 과정 소개 탐구 동기 수업시간에 흔히 듣던 DNA 가 아닌 RNA 의 ... 유라실이 결합하는 이유에 대해 깊이 탐구해보고 싶었음 . DNA 와 RNA ... 사이토신 C 타이민 T ※ 핵산 : DNA 나 RNA. 뉴클레오타이드가 모인것
    리포트 | 14페이지 | 2,000원 | 등록일 2021.09.19 | 수정일 2021.10.11
    다운로드 장바구니
  • 한글파일 PCR protocol - 조직에서의 RNA 추출
    것을 사용한다. Ⅰ. 조직에서의 RNA extraction 1. 얼음이 ... night 11. 육안으로 보았을 때 RNA가 침전 된 것을 확인해준다 ... . * volume이 낮은 pipet을 이용하며, 상층액을 많이 남기면 RNA
    리포트 | 1페이지 | 1,000원 | 등록일 2019.05.13
    다운로드 장바구니
  • 워드파일 RNA extraction
    Total RNA Extraction 실험결과 (실패 이유): 사람의 ... 것이다. 우리 조는 실험에 실패하였는데 RNA를 찌꺼기와 분리하는 트리 ... RNA를 파괴하지는 않는다. 이 트리졸이 DNA를 제대로 변성시키지 못했다면 ... 이는 또 결과에 영향을 미쳤을 것이다. 그런데 우리는 실험에 RNA ... RNase 효소를 inactive시키고 RNase에 의해 RNA
    리포트 | 2페이지 | 300원 | 등록일 2017.12.13
    다운로드 장바구니
  • 한글파일 DNA RNA 구조의 이해
    DNA RNA 구조의 이해 2019/09/24 실험 목적 DNA 이중 ... 나선 구조 모형을 확인하고, RNA 단일 가닥 2차 구조를 수치적 측정을 ... 알려져 있다. 4. RNA는 왜 복잡한 2차 구조를 가질까? RNA 구조를 ... 상보적으로 역평행하며 연결되어 있는데 RNA는 아예 단일 가닥이다 ... 힘들이 균형을 이루며 형태를 유지하고 있다. 하지만 우선 RNA는 단일
    리포트 | 4페이지 | 1,000원 | 등록일 2020.03.27
    다운로드 장바구니
  • 한글파일 A+보장, 생화학 RNA 추출 및 정량 예비레포트
    제7주차 RNA Preparation & Quantification ... 예비 Report 1. 실험제목 : RNA Preparation ... & Quantification 2. 이론 및 관련 원리 1) RNA의 종류, 역할 ... , 특징을 조사하시오. ? Coding RNA ? mRNA ... : Messenger RNA (mRNA) is the RNA that carries
    리포트 | 10페이지 | 1,500원 | 등록일 2019.12.25
    다운로드 장바구니
  • 파워포인트파일 [세포생물학실험] RNA isolation 실험 발표자료
    RNA isolation 1. 이론 RNA isolation PCR ... RT-PCR cDNA RNA Ribonucleic acid 의 약기이 며 ... 외가닥 사슬모양 중합체를 형성한 polynucleotide 가 RNA ... 이다 . 약 알칼리나 Rnase 에 의해 쉽게 분해되며 RNA 분리가 ... 오염에 주의해야한다 . RNA RNA 의 종류는 기능에 따라 리보솜을
    리포트 | 16페이지 | 1,500원 | 등록일 2019.12.07
    다운로드 장바구니
  • 한글파일 RNA extraction 보고서
    생명과학 연구실습보고서 주제: RNA extraction 목적 ... : mouse tissue에서 RNA를 추출해본다. 연수내용 및 고찰 ... , 30min, 4℃. (층이 3개로 나뉜다. 맨 위층-RNA/ 흰색 얇은 ... 중간층-genomic DNA/ 맨 아래층- 지질+단백질) ⑤ RNA가 녹아 ... , 4℃ ⑦ pellet(RNA, salt)을 확인하고 상층액을 흘려버린
    리포트 | 1페이지 | 1,000원 | 등록일 2019.12.04 | 수정일 2021.07.14
    다운로드 장바구니
  • 파일확장자 [실험프로토콜] RNA extraction
    min, 2-8 ℃ RNA Precipitation 4 ... -8 ℃RNA Wash and Resuspension 7
    리포트 | 29페이지 | 3,000원 | 등록일 2017.05.12
    다운로드 장바구니
  • 한글파일 [분자생물학실험]RNA Isolation and analysis
    1. 실험 목적가. 세포에서 RNA를 추출하기 위해서 RNA를 RT ... 원리가. RNA 추출 원리포유세포는 보통 한 세포 당 10-5㎖ RNA ... , 1∼5%가 mRNA로 이루어져 있다. 리보솜 RNA나 tRNA 등은 ... )를 가지고 있기 때문에 리보솜 RNA나 tRNA 등으로부터 분리해 낼 수 ... 있다.RNA를 추출할 때 가장 주의해야 할 점은 핵산 가수분해효소에
    리포트 | 9페이지 | 3,500원 | 등록일 2018.09.26 | 수정일 2020.08.05
    다운로드 장바구니
  • 한글파일 [생화학] 세포의 RNA 추출
    9주. 세포의 RNA 추출 실험 일시: 2020년 5월 20일 수 ... 요일 1. 실험 목적 및 원리 9주 차 실험으로 세포의 RNA를 추출하는 ... 실험을 진행하였다. RNA는 유전자 정보를 매개하고, 유전자 발현의 조절 ... , DNA의 정보는 RNA의 형태가 되어야 단백질을 생산할 수 있다. RNA ... 는 유전자 발현에 필수적인 역할을 하므로 매우 중요한 핵산이며, RNA
    리포트 | 8페이지 | 1,000원 | 등록일 2020.06.05
    다운로드 장바구니
  • 한글파일 RNA isolation and electrophoreis RNA 추출하여 전기영동으로 확인하기
    1.Title: Yeast에서 RNA를 추출하고 이를 전기 ... 영동으로 확인할 수 있다. (RNA preparation) 2 ... . Introduction -Yeast RNA RNA는 DNA가 Protein으로 합성되기 위한 ... 중요한 역할을 한다. RNA의 대부분은 rRNA이며 tRNA, mRNA ... 물질)적 stress에 의해 쉽게 손상을 입는다. 또한, RNA
    리포트 | 4페이지 | 1,500원 | 등록일 2020.12.30
    다운로드 장바구니
  • 한글파일 small nuclear RNA, micro RNA, siRNA의 구조와 기능
    < 생화학 과제 > 생체내에 존재하는 RNA 중 small ... nuclear RNA, micro RNA, siRNA의 구조와 기능 정밀화학과 ... 15125305 김민수 snRNA (small nulear RNA) pre ... 핵 RNA(nuclear RNA)를 말한다. 가끔 어떤 인트론에서는 5 ... 개 중 2개가 변하는데 이 2개의 핵 RNA역시 snRNA로 간주한다
    리포트 | 8페이지 | 1,000원 | 등록일 2021.08.16
    다운로드 장바구니
  • 워드파일 DNA,RNA 구조의 이해 레포트
    DNA/RNA 구조의 이해 2017년 3월 13일 ... computational prediction 을 이용해 제시된 RNA 서열의 세포 내 2차 ... -3' ② 5'- AGCCCGCCUAAUGAGCGGGCU -3' RNA 2 ... 차 구조 예측 웹 프로그램에 RNA 서열을 넣으면 주어진 RNA 서열에 ... 따른 세포 내에서의 RNA 2차 구조를 눈으로 확인할 수 있다. RNA
    리포트 | 3페이지 | 500원 | 등록일 2020.02.06
    다운로드 장바구니
  • 파워포인트파일 [진로연계 수학 발표 대회 금상] 옛날에는 어떻게 RNA의 염기서열을 분석했을까?-오일러회로
    옛날에는 어떻게 RNA 의 염기서열을 분석했을까 ? 이름 목 차 오일러 ... 회로 RNA 염기서열 분석 1 1 오일러 회로 1 1. 오일러 회로 ... 2 인 것이다 . 1 2 RNA 염기서열 분석 1 2. RNA 염기 ... GAGC A AGUCAGUGAGCA AGUCAGUGAGCA 2. RNA ... AG U C AG U G AG C A 2. RNA 염기서열 분석 U C
    리포트 | 19페이지 | 2,000원 | 등록일 2021.02.23 | 수정일 2021.07.08
    다운로드 장바구니