• AI글쓰기 2.1 업데이트
  • 통합검색(3,214)
  • 리포트(2,572)
  • 시험자료(315)
  • 자기소개서(114)
  • 서식(66)
  • 논문(50)
  • ppt테마(48)
  • 이력서(29)
  • 방송통신대(18)
  • 노하우(2)
  • 기간
  • 연관순
  • 영역
  • 페이지 수
  • 확장자
  • 할인자료 보기

연관검색어

lesson plan 리딩 레슨플랜 west프로그램 초등영어 지도안 영어문법 essay on criticism 토익 LC pelt 7
판매자 표지는 다운로드시 포함되지 않습니다.

"Dramatherapy using the Writing by Oneself" 검색결과 261-280 / 3,214건

  • 자료 표지
    [언어와 문화 A+ 과제] The significance of English (language) in my life
    distinct cultural features of the society that uses the language. Hence, being able to speak or write in ... general use of the term « language » most commonly implies “verbal and written means of communication ... The significance of English (language) in my lifeOut of all the creations of human society
    Non-Ai HUMAN
    | 리포트 | 5페이지 | 2,000원 | 등록일 2022.03.16
    다운로드 장바구니
  • 자료 표지
    GRE Writing argue 128
    throughout all twelve buildings in the Sunnyside Towers complex will increase our profits further."Write a ... may merely cause people to take a shower for a longer time, ultimately using the amount of water s ... due to inconvenience caused by low water pressure, which will decrease the company's income
    Non-Ai HUMAN
    | 시험자료 | 2페이지 | 1,500원 | 등록일 2020.12.26
    다운로드 장바구니
  • 자료 표지
    해리포터 감상문(영문)
    even know that he was a wizard. His parents were both murdered by the dark wizard, but Harry somehow ... invisibility cloak his father used. At this point, I wondered what would I do if I had the cloak. I ... After reading Harry Potter 1It’s been a while since I read the Harry Potter series, so it was as if
    Non-Ai HUMAN
    | 리포트 | 2페이지 | 1,500원 | 등록일 2021.03.13
    다운로드 장바구니
  • 자료 표지
    English Syntax and Argumentation 10과 요약 정리
    ) The result may have been influenced by the weather. 결과는 날씨의 영향을 받았을 수 있다.10.2.2.2 Uses of the ... 적.I amwe areyou areyou arehelshe isthey are10.1.1.1 Uses of the present tense현재 시제의 사용현재 시제의 상태 사용 ... write to you again once I have the results.결과가 나오면 다시 편지를 드릴게요.->여기서 조동사는 '의도'intention의 의미를 표현->will
    Non-Ai HUMAN
    | 리포트 | 12페이지 | 2,000원 | 등록일 2021.06.08
    다운로드 장바구니
  • 자료 표지
    밀레니얼 세대 공략하는 스낵 '히피스(Hippeas)'
    useful if you have a unique product or are a starter in the market. Millennial moms can try new snacks ... manufacturing products that provide consumers with healthy options by combining the experience of working in the ... brand. The brief for a product called ‘Hippeas’ writes itself so does the marketing no tough sledding
    Non-Ai HUMAN
    | 리포트 | 3페이지 | 1,500원 | 등록일 2021.03.24 | 수정일 2022.10.29
    다운로드 장바구니
  • 자료 표지
    인하대 비즈니스 영어 과제 케이스스터디 7~11
    Case Study 7: Taka Shimizu CyclesWriting Assignment: Write an e-mail to the Head of the Chamber of ... Head of the Chamber of Commerce of COUNTRY B,I am writing to make a proposal. I want to build a new ... the price of the jacket by about $100. Even if we raise $100, it's not that high compared to other
    Non-Ai HUMAN
    | 시험자료 | 7페이지 | 5,500원 | 등록일 2022.01.12
    다운로드 장바구니
  • 자료 표지
    영어과 연구수업 지도안
    -infinitive∙ Emphasizing the sentences by using ‘It was ~ that~’.∙ Complete the sentences with the expression ... , Pictures, TaskSheets, Board,Video Clip9thLet’s Write∙ Understand the sentence with a subject of to ... ) Students can understand the meanings and functions of the target communicative expressions by
    Non-Ai HUMAN
    | 리포트 | 10페이지 | 4,000원 | 등록일 2020.12.27 | 수정일 2022.04.04
    다운로드 장바구니
  • 자료 표지
    Exploring the Writing Strategies Perceived and Actually Used by Less Experienced Students in English Writing through Surveys and the Think-Aloud Method Observation (Exploring the Writing Strategies Perceived and Actually Used by Less Experienced Students in English Writing through Surveys and the Think-Aloud Method Observation)
    한국외국어대학교 외국어교육연구소 박은화
    논문 | 20페이지 | 무료 | 등록일 2025.04.15 | 수정일 2025.05.09
    다운로드
  • 판매자 표지 자료 표지
    2024 사학과 편입 전공면접 기출문제
    were yesterday put to me by his imperial majesty; the first, whether I was the author of the books ... . I answered the first, and I adhere to that answer: that these books are mine and published by me. As ... to the second, I have composed writings on very different subjects. In some I have discussed Faith
    자기소개서 | 19페이지 | 30,000원 | 등록일 2023.10.18 | 수정일 2023.12.15
    다운로드 장바구니
  • 자료 표지
    English syntax and argumentation 전단원 중요한 내용 빈칸문제입니다
    Introduction1) Write the two meanings of sentence : I went to a conference on language in France1.2 ... .2) We will use the term ( ) for strings of one or more words that syntactically and semantically ... (write, sulk, sadden, take) in these sentences ( ) with the subjects (she, James, this book, our
    Non-Ai HUMAN
    | 시험자료 | 13페이지 | 3,000원 | 등록일 2021.11.16
    다운로드 장바구니
  • 자료 표지
    Lessonplan, 영어교과지도안
    our understanding of the story using two worksheets, so we have achieved No.1 objective, right ... ? ▶ Good work, then let’s move on to the next activity. ▶ (Look at the text book) ▶ Yes. ▶ Do not use ... it. ▶ Did everyone get a copy? ▶ Right, as you can see, the last question is to write down what was
    Non-Ai HUMAN
    | 리포트 | 5페이지 | 3,500원 | 등록일 2022.02.20
    다운로드 장바구니
  • 자료 표지
    [유기공업화학실험 A+] Grignard reaction 결과 레포트
    번 phenylmagnesium bromide. Write stepwise reaction mechanisms for these two reactions.If the ethyl ... benzoate used to prepare triphenylmethanol is wet, what by-product is formed?→ wet한 상태이므로 Grignard ... 가 충분히 건조되지 않았기 때문에.The benzoic acid could have been extracted from the ether layer using sodium
    Non-Ai HUMAN
    | 리포트 | 15페이지 | 1,500원 | 등록일 2021.08.11
    다운로드 장바구니
  • 자료 표지
    삐도리의 인포그래픽 PPT 탬플릿 268
    , but the majority have suffered alteration in some form, by injected humour , or randomised words ... passages of Lorem Ipsum available, but the majority have suffered alteration in some form, by injected ... a long established fact that a reader will be distracted by the readable content of a page when
    ppt테마 | 90페이지 | 1,500원 | 등록일 2024.01.13
    다운로드 장바구니
  • 판매자 표지 자료 표지
    행정영어 기말고사
    those who will ④ be affected by the change.9. Younger students ① who participated in the survey ② s ... ponsored by a weekly magazine turned out ③ to be less concerned about the serious problems of homeless ... for a short nap every afternoon.④ The instructions require that we not use a red pen.18. ① The
    시험자료 | 4페이지 | 2,000원 | 등록일 2023.03.21
    다운로드 장바구니
  • 자료 표지
    건국대학교 핵산생화학 중간고사 족보
    just one strand. This was assessed by using the circular plasmid pBR322. The plasmid is the most s ... )GCGCAATATTTCTCAAAATATTGCGC(3). Write the base sequence of the complementary strand. What special ... mg/mL이다. 5. The following DNA fragment was sequenced by the Sanger method. The asterisk indicates a
    시험자료 | 11페이지 | 3,000원 | 등록일 2024.06.26
    다운로드 장바구니
  • 자료 표지
    한글이 창제된 이후에도 한동안 한문으로 쓰여진 작품들이 주류를 이루었는데, 그 이유는 무엇이며, 이후에 한글 문학이 주류를 이루게 된 계기는 무엇인지 서술하시오.
    perhaps the most scientific system of writing in general use in any country)'고 극찬하였다. 라이샤워 교수는 로마자 ... University of Michigan)》이었다. 서평에는 다음과 같은 내용이 들어 있다."Vos's use of the superlative has much justification, s ... ince the han'g ul anticipates by over 400 years the idea of Alexander Melville Bell's 'Visible Speech
    Non-Ai HUMAN
    | 리포트 | 4페이지 | 3,500원 | 등록일 2022.02.21 | 수정일 2022.02.23
    다운로드 장바구니
  • 판매자 표지 자료 표지
    스토리텔링 레포트(레슨플랜 만들기)
    : Written and Illustrated by H.A.Lay.(Books story)This is George. He lived in the Zoo.He was a good little ... moved the location of trouble.★Let's make a pop-up book (Writing and reading)T: Look at my book. What's ... 스토리텔링 과제물 : 레슨플랜 만들기학번 : 20******** 성명 : 정**TifeCurious George(by H.A.Rey)StudentsAge: 7~10Class
    Non-Ai HUMAN
    | 리포트 | 3페이지 | 4,000원 | 등록일 2022.02.28 | 수정일 2022.03.01
    다운로드 장바구니
  • 자료 표지
    How I learned to drive review - 감상문, 에세이 인물분석
    Understanding How I learned to Drive by Analyzing Characters과학번이름Analyzing the characters of the ... needed in life and starting her journey with herself.Paula Vogel writes the play to make sure that ... Uncle Peck is looked as the abuser and Li’l Bit as the victim. She does this not only writing about
    Non-Ai HUMAN
    | 리포트 | 5페이지 | 2,500원 | 등록일 2020.12.21
    다운로드 장바구니
  • 판매자 표지 자료 표지
    Final Exam_Aalto_MBA_Operations Management
    : (signature)Please write a short essay (within 7 to 8 sentences) to the following questions. All the ... )>>> Companies compete in the marketplace by virtue of one or more of the following competitive ... launan use the risk pulling strategy and information technology. Risk Pooling involves using c
    시험자료 | 4페이지 | 2,000원 | 등록일 2023.02.04 | 수정일 2023.02.06
    다운로드 장바구니
  • 자료 표지
    [산업통상자원부] 방산물자 및 국방과학기술 중개 허가 (신청)서
    by way허가내용Permitsrequire허가번호 License No.허가조건 License Condition최종사용용도 End-use허가유효기간 Terms of Validity ... Name성명 Name소재지 Address전화번호 Telephone※ 수입자와 같을 시 "수입자와 동"으로 기재 If same as Importer, write "same as ... 과 동"으로 기재 If same as Ultimate Consignee, write "same as Ultimate Consignee"※ 최종 사용자의 수가 2명 이상인 경우 "별지
    서식 | 3페이지 | 무료 | 등록일 2023.03.13
    다운로드 장바구니
  • 콘크리트 마켓 시사회
  • 전문가요청 배너
해캠 AI 챗봇과 대화하기
챗봇으로 간편하게 상담해보세요.
2025년 11월 27일 목요일
AI 챗봇
안녕하세요. 해피캠퍼스 AI 챗봇입니다. 무엇이 궁금하신가요?
9:01 오전
문서 초안을 생성해주는 EasyAI
안녕하세요 해피캠퍼스의 20년의 운영 노하우를 이용하여 당신만의 초안을 만들어주는 EasyAI 입니다.
저는 아래와 같이 작업을 도와드립니다.
- 주제만 입력하면 AI가 방대한 정보를 재가공하여, 최적의 목차와 내용을 자동으로 만들어 드립니다.
- 장문의 콘텐츠를 쉽고 빠르게 작성해 드립니다.
- 스토어에서 무료 이용권를 계정별로 1회 발급 받을 수 있습니다. 지금 바로 체험해 보세요!
이런 주제들을 입력해 보세요.
- 유아에게 적합한 문학작품의 기준과 특성
- 한국인의 가치관 중에서 정신적 가치관을 이루는 것들을 문화적 문법으로 정리하고, 현대한국사회에서 일어나는 사건과 사고를 비교하여 자신의 의견으로 기술하세요
- 작별인사 독후감
“EasyAI 가 작성한 문서 초안은 완벽하지 않을 수 있습니다"
EasyAI 이동하기