포항공대 화학생명공학실험[포스텍 A]Final-Report(Sequencing Analysis of Target DNA)

최초 등록일
2020.06.06
최종 저작일
2017.04
7페이지/워드파일 MS 워드
가격 1,000원 할인쿠폰받기
판매자미생 (본인인증회원)
다운로드
장바구니
퀴즈풀이 출석이벤트

소개글

포항공대 화학공학과 전공필수 과목인
화학생명공학실험 보고서입니다
PRE-Report 는 실험전 사전지식을 정리하는 보고서이고
Final-Report는 실험후 결과를 정리하는 보고서 입니다.

두가지를 모두 참고하셔서 과제에 도움이 되시길 바랍니다.

목차

1. 실험 제목

2. Data 및 결과
1) 1번 서열
2) 3번 서열

3. 토의
1) 1번 서열은 어떤 미생물의 서열인가?
2) 대조군 1, 2번 서열은 어떠한가?

4. 결론

본문내용

1. 실험 제목
Sequencing Analysis of Target DNA

2. Data 및 결과
Colony를 PCR 한 후 23f primer를 바탕으로 sequencing을 의뢰하였다. 그 결과 7개의 데이터를 얻을 수 있었다. 2번째 데이터를 제외한 나머지는 거의 정확한 서열이었다. 2번째 데이터는 서열의 절반 정도가 ‘N’ 으로 sequencing되어 BLAST 분석을 하기 어려운 상태였다. 1번 서열은 1047bp, 2번 서열은 1169bp, 3번은 1066bp, 4번은 1209bp, 5번은 1019bp, 6번은 375bp, 7번은 304bp 의 길이를 갖고 있다. 5번을 기준으로 1~5번은 1000bp 정도, 6~7번은 300bp 였다. 대조군 1은 1047bp, 2는 1054bp이다. (그 중 분석하고자 하는 서열을 2개 골라보았다.)

- 1번 서열
TCGACGGTGCAGGAGTAAGCTTGCTTCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCG..

<중 략>

참고 자료

Sambrook et al Molecular Cloning 3rd Ed. Vol.2 Chapter 12

자료문의

ㆍ이 자료에 대해 궁금한 점을 판매자에게 직접 문의 하실 수 있습니다.
ㆍ상업성 광고글, 욕설, 비방글, 내용 없는 글 등은 운영 방침에 따라 예고 없이 삭제될 수 있습니다.
ㆍ다운로드가 되지 않는 등 서비스 불편사항은 고객센터 1:1 문의하기를 이용해주세요.

미생
Silver개인인증
팔로워0팔로우
판매자 스토어 자료요청OFF
소개
회원 소개글이 없습니다.
전문분야 등록된 전문분야가 없습니다.
판매자 정보
학교정보
비공개
직장정보
비공개
자격증
  • 비공개
판매지수

주의사항

저작권 자료의 정보 및 내용의 진실성에 대하여 해피캠퍼스는 보증하지 않으며, 해당 정보 및 게시물 저작권과 기타 법적 책임은 자료 등록자에게 있습니다.
자료 및 게시물 내용의 불법적 이용, 무단 전재∙배포는 금지되어 있습니다.
저작권침해, 명예훼손 등 분쟁 요소 발견 시 고객센터의 저작권침해 신고센터를 이용해 주시기 바랍니다.
환불정책

해피캠퍼스는 구매자와 판매자 모두가 만족하는 서비스가 되도록 노력하고 있으며, 아래의 4가지 자료환불 조건을 꼭 확인해주시기 바랍니다.

파일오류 중복자료 저작권 없음 설명과 실제 내용 불일치
파일의 다운로드가 제대로 되지 않거나 파일형식에 맞는 프로그램으로 정상 작동하지 않는 경우 다른 자료와 70% 이상 내용이 일치하는 경우 (중복임을 확인할 수 있는 근거 필요함) 인터넷의 다른 사이트, 연구기관, 학교, 서적 등의 자료를 도용한 경우 자료의 설명과 실제 자료의 내용이 일치하지 않는 경우

찾던 자료가 아닌가요?아래 자료들 중 찾던 자료가 있는지 확인해보세요

더보기
우수 콘텐츠 서비스 품질인증 획득
최근 본 자료더보기
포항공대 화학생명공학실험[포스텍 A]Final-Report(Sequencing Analysis of Target DNA)