• AI글쓰기 2.1 업데이트
  • 통합검색(2,579)
  • 리포트(1,894)
  • ppt테마(377)
  • 시험자료(161)
  • 논문(58)
  • 서식(36)
  • 자기소개서(25)
  • 방송통신대(15)
  • 이력서(13)
  • 기간
  • 연관순
  • 영역
  • 페이지 수
  • 확장자
  • 할인자료 보기

연관검색어

ppt템플릿 ppt배경 영어유치원 논문발표 ppt양식 예쁜 ppt템플릿 요리사 ppt 조현병 간호진단 글로벌 교육 ppt 토익문제 Agitation
판매자 표지는 다운로드시 포함되지 않습니다.

"presentation of form" 검색결과 161-180 / 2,579건

  • 자료 표지
    The kite runner(연을 쫓는 아이) 영어독후감
    The kite runnerI read this book because a classmate presented this during class and it seemed ... interesting. Amir was born from a wealthy family of Afghanistan and he had a servant boy named Hassan ... felt guilt from this and made Hassan and his dad to get out of his house. After Hassan went out, Amir
    Non-Ai HUMAN
    | 리포트 | 2페이지 | 1,000원 | 등록일 2021.07.21
    다운로드 장바구니
  • 자료 표지
    Major depressive disorder 케이스 레포트
    vu / Jamais vu (-/-)5) Thought content and mental trends- Form of thoughtAutistic thinking ( ... : 고등학교 때, 1년 전부터 악화)2. 알코올 의존 (2개월 전부터 악화)3. 우울증 (onset : 작년 이맘때)4. Present Illness? 상기환자 내원 1년 전 우울증 ... - Speed of speech: normal- Verbal productivity: normal- Spontaneity of speech : (+)- Volume&Tone
    Non-Ai HUMAN
    | 리포트 | 8페이지 | 3,000원 | 등록일 2021.11.15
    다운로드 장바구니
  • 판매자 표지 자료 표지
    모란디 작품 리포트
    Giorgio Morandi : Repose and Energy조르지오 모란디 : 고요함과 에너지This paper was presented first in 1983 at the ... rucial in understanding the art of any time. Referring to the Fifteen Questions by Eli Siegel, “Is ... Beauty the Making One of Opposites?” I looked at the prints and paintings of Giorgio Morandi, the
    Non-Ai HUMAN
    | 리포트 | 6페이지 | 2,500원 | 등록일 2022.04.28
    다운로드 장바구니
  • 자료 표지
    교양(서양 문화의 유산) 르네상스 부분 레포트
    developed by transporting military supplies,and each city formed a sphere of influence andhad a unique ... ommunities presented the Renaissance people with a war criminal of free humanity.2) Theological view of e. ... Renaissance切苞_捞抚? Background of the birth of genius artists in the Renaissance. ?1. How did the c
    리포트 | 6페이지 | 4,500원 | 등록일 2023.08.26
    다운로드 장바구니
  • 자료 표지
    미국대학_과제_동양미술역사_Asian Art History_UNC-CH_Paper_Li Cheng_Ju Ran
    even sticks out with an angled shape. The shape of the mountains formed by such angled lines is keen ... he leafy part where the trees are arranged in a form of road that stretches to the top. Another c ... this paper, Zhao Boju’s River and Mountains in Autumn Color, sends a theme of strength to viewers and
    Non-Ai HUMAN
    | 리포트 | 7페이지 | 2,000원 | 등록일 2020.12.26 | 수정일 2022.12.08
    다운로드 장바구니
  • 자료 표지
    Food Commodity Chain - Cacao Bean 카카오열매가 초콜릿이 되기까지의 과정
    Yucatan Peninsula. Later Aztecs grew cacao in the form of a farm and even escorted it to the army ... and child-labor is present in the cocoa industry. In "The Dark Side of Chocolate" they exposed this ... The Commodity Chain of Cacao BeanCacao is believed to have been used since around 1000 B.C. by the
    Non-Ai HUMAN
    | 리포트 | 5페이지 | 3,500원 | 등록일 2020.12.23
    다운로드 장바구니
  • 자료 표지
    미국사회와문학 The Fall of the House of Usher
    House of Usher, the actual structure, and the family. The windows of the House are presented with ... level of family isolation is so high that they have developed their unique form of interaction using ... Fall of the House of UsherOne interesting point in the story on the fall of the House of Usher is
    Non-Ai HUMAN
    | 리포트 | 2페이지 | 1,000원 | 등록일 2020.12.13
    다운로드 장바구니
  • 자료 표지
    Genipin-crosslinked catechol-chitosan mucoadhesive hydrogels for buccal drug delivery
    a device that enables the introduction of a therapeutic substance in the body and improves its ... efficacy and safety by controlling the rate, time, and place of release of drugs in the body . T o ... deliver the drug at a rate directed by the needs of the body during the period of treatment, and target
    Non-Ai HUMAN
    | 리포트 | 31페이지 | 1,000원 | 등록일 2021.06.15
    다운로드 장바구니
  • 판매자 표지 자료 표지
    가열살귤_High Voltage Electric Discharges
    been applied to the chemical removal of organic impurities present in water, oil extraction and other ... Engineering XXXIndex High Voltage Electric field Formation and propagation of streamer and arc Formation ... of the vapor cavities Formation of the shock wave Disintegration of cell structure Conclusion
    리포트 | 15페이지 | 2,000원 | 등록일 2023.07.07
    다운로드 장바구니
  • 자료 표지
    건국대학교 핵산생화학 중간고사 족보
    Nucleic Acid Biochemistry -Midterm Exam- 1. One strand of a double-helical DNA has the sequence (5 ... )GCGCAATATTTCTCAAAATATTGCGC(3). Write the base sequence of the complementary strand. What special ... type of sequence is contained in this DNA segment? Does the double-stranded DNA have the potential to
    시험자료 | 11페이지 | 3,000원 | 등록일 2024.06.26
    다운로드 장바구니
  • 자료 표지
    v-sim Li Na Chen case-study 간호과정 (사정, 진단, 계획, 중재, 평가). 간호진단 2개
    이렇게 살 수 없어요.“3. 현 병력(History of present illness)① 사정일의 주 증상# 우울감(Depressive mood) : 면담 당시 대상자의 기분을 묻 ... delusions.16. LOSS OF WEIGHT0 No weight loss.1 Probable weight loss associated with present illness ... . 기분과 정동이 일치하였음.4. 사고과정(Thought process)4-1. 사고형태(form of thought)사고는 직선적이고 논리적으로, 질문에 맞는 대답을 할 수 있
    Non-Ai HUMAN
    | 리포트 | 23페이지 | 3,500원 | 등록일 2021.11.11 | 수정일 2022.05.30
    다운로드 장바구니
  • 판매자 표지 자료 표지
    영어임용대비자료-SLA mapping
    form that results from the addition of a derivational morpheme is called a derived word. The derived ... MorphologyⅠ. Morpheme & Types of morphemes1. Morpheme & Allomorph① Morpheme(형태소): 의미를 가진 최소의 단위 ... (minimal meaningful unit)② Allomorph(이형태): 한 형태소의 여러 변이형※ Allomorph: variants of the same morpheme① -s
    시험자료 | 4페이지 | 2,000원 | 등록일 2025.04.15
    다운로드 장바구니
  • 자료 표지
    경제분석의 역사 ) 4강에서 존 스튜어트 밀의 주장, 특히 장기 정체 상태(stationary state)에 관련된 내용을 요약 정리했다.
    ondition of society, so greatly preferable to the present, is not only perfectly compatible with the s ... : “It must always have been seen, more or less distinctly, by political economists, that the increase of ... wealth is not boundless: that at the end of what they term the progressive state lies the s
    리포트 | 5페이지 | 3,500원 | 등록일 2025.05.21
    다운로드 장바구니
  • 자료 표지
    대학영어 Learning reflection 러닝 리플렉션
    presentation next week. I finished the quiz late, so there were only front and end of order left. I ... level of University English because I am not good at English. I was a little sad because my friends ... worried that I could do well in the class. He also explained about the skills of discussion. He told us
    Non-Ai HUMAN
    | 리포트 | 7페이지 | 2,500원 | 등록일 2021.04.12
    다운로드 장바구니
  • 자료 표지
    영문소설 'Atonement (속죄)' 영어 리포트, 총 7 페이지, A+ (끝에 스캔본 인증)
    form of flight, of fancy, of the imagination? (p.147, line 15)Unlike the adults, she had no torch ... Maturing for Imagination:A Panorama of Briony’s Writing Principles and its Affected BehaviorCourse ... : Contemporary English LiteratureMajor: English LiteratureⅠ. IntroductionA lot of the time we ask
    Non-Ai HUMAN
    | 리포트 | 7페이지 | 2,500원 | 등록일 2021.02.17
    다운로드 장바구니
  • 자료 표지
    소논문_뇌의 주요 기능과 질환
    는 남자 HM의 기억(원제: Permanent Present Tense). 이 민아 옮김, 알마이애영. (2013). 기억의 분류와 담당 뇌구조 [PDF]. 2013년 대한신경과학회 제 ... 의 기억이론. 현상학과 현대철학, 65(), 29-59.조수진. (2012). 기억처리과정의 이해. 2012 Korean Academy of Audiology.송민령. (2016 ... , 08, 22). 나이 들면 머리 굳는다? 아니, 뇌는 변화한다. -가소성. 사시언스온. Retrieved form Hyperlink "http://scienceon.hani.co
    리포트 | 8페이지 | 5,000원 | 등록일 2024.01.04
    다운로드 장바구니
  • 판매자 표지 자료 표지
    Urinary tract infection Adult vs. pediatric 요로감염 성인 대 소아
    -Pediatric Most common serious bacterial infection since the introduction of successful immunizations ... onsidered as a possible diagnosis in all febrile infants and young children presenting to EDs and in ... years of age Starting at 50, men experience an increasing frequency of UTIs as they grow older due to
    리포트 | 17페이지 | 2,500원 | 등록일 2024.03.27
    다운로드 장바구니
  • 판매자 표지 자료 표지
    두번째 언어를 향상시키기 위해선 첫번째 언어를 향상시켜야 한다. To improve second language, first language has to be reinforced. 영어레포트
    actually in correlation with each other. According to Ellis (1985), first language is one of the ... certain aspects of second language acquisition that should be supported by first language ... acquired only once by each individual. When they are developed enough, common underlying proficiency of
    Non-Ai HUMAN
    | 리포트 | 8페이지 | 2,500원 | 등록일 2022.08.19
    다운로드 장바구니
  • 자료 표지
    [특허청] 국제출원서
    ontinuation sheets:Number of MM17 forms:MM18 form (if applicable, check the box)Applicant’s reference ... ” attached to this form.4. APPOINTMENT OF A REPRESENTATIVE8(a)Name:(b)Address:(c)E-mail address9:(d ... account.For use by the applicant::Number of continuation sheets for several applicants:Number of c
    서식 | 17페이지 | 무료 | 등록일 2023.03.13
    다운로드 장바구니
  • 자료 표지
    Hotel & Traveling Marketing - The End of Luxury, Radisson Blu Cebu
    Descriptive Paper (Midterm)Name.Hotel & Traveling MarketingProfessor NameDATEThe End of Luxury ... , Radisson Blu CebuHave you ever visited paradise? Or have you ever heard of Radisson Blu Cebu hotel? If ... SM City Cebu mall. The accurate address of this hotel is Serging Osmena Boulevard, Corner Pope John
    Non-Ai HUMAN
    | 리포트 | 4페이지 | 2,500원 | 등록일 2021.12.26
    다운로드 장바구니
  • 전문가 요청 쿠폰 이벤트
해캠 AI 챗봇과 대화하기
챗봇으로 간편하게 상담해보세요.
2025년 12월 10일 수요일
AI 챗봇
안녕하세요. 해피캠퍼스 AI 챗봇입니다. 무엇이 궁금하신가요?
9:12 오후
문서 초안을 생성해주는 EasyAI
안녕하세요 해피캠퍼스의 20년의 운영 노하우를 이용하여 당신만의 초안을 만들어주는 EasyAI 입니다.
저는 아래와 같이 작업을 도와드립니다.
- 주제만 입력하면 AI가 방대한 정보를 재가공하여, 최적의 목차와 내용을 자동으로 만들어 드립니다.
- 장문의 콘텐츠를 쉽고 빠르게 작성해 드립니다.
- 스토어에서 무료 이용권를 계정별로 1회 발급 받을 수 있습니다. 지금 바로 체험해 보세요!
이런 주제들을 입력해 보세요.
- 유아에게 적합한 문학작품의 기준과 특성
- 한국인의 가치관 중에서 정신적 가치관을 이루는 것들을 문화적 문법으로 정리하고, 현대한국사회에서 일어나는 사건과 사고를 비교하여 자신의 의견으로 기술하세요
- 작별인사 독후감
“EasyAI 가 작성한 문서 초안은 완벽하지 않을 수 있습니다"
EasyAI 이동하기