[자연과학]핵산

DirectorY
최초 등록일
2000.09.14
최종 저작일
2000.09
7페이지/한글파일 한컴오피스
가격 400원 할인쿠폰받기
다운로드
장바구니

목차

1.Nucleic Acid Structure
2. DNA 구조 결정요인

본문내용

1.Nucleic Acid Structure
DNA는 living cell에서 가장 중요한 분자이며 세포의 특성이 기록된 정보를 모두 가지고 있다.
1) Base-pairing and the DNA Double Helix
일찍이 DNA의 물리학적인 연구에서 다양한 실험으로 DNA는 고도로 정렬된 구조를 가진 길게 확대된chain,이라는 것이 알려졌다. 가장 중요한 기술은 x-ray diffraction analysis(x-ray 회절 분석)이며 이기술에 의해 DNA의 여러 부분의 arrangement와 dimemsion에 대한 정보를 얻게 되었다. DNA는helical이고 nucleotide의 base는 0.34nm 간격으로 stack되어 있다(차곡차곡 쌓여 있다). 많은 생물체에서 분리된 DNA분자에서 adenine, thymine, guanine, cytosine같은 base구성성분(일반적으로 base composition이라 불리는)의 화학적인 분석은 [A]=[T]와 [G]=[C]는 중요한 사실을 제공하였고 이것은 다음과 같이 추론할 수 있다. [A+G]=[T+C] 또는 [purines]=[pyrimidines]
James Watson과 Francis Crick은 x-ray diffraction diagram을 가지고 DNA에 대한 화학적, 물리학적자료를 종합하여 DNA에는 2개의 helical strand가 존재한다고 제안하였고 그 두 가닥들은double-stranded helix를 형성하기 위해 서로 꼬여 있다는 것을 보여주였다. Sugar-phosphatebackbone은 DNA의 바깥쪽에 나선형으로 존재하고 있고 bases는 나선형 배열의 중심부에 있다. 한가닥의 base는 다른 가닥의 base와 수소결합하여 A․T와 G․C 의 purine과 pyrimidine base pairs를형성하고 있다. 각 쌍은 두 개의 ring을 가진 purine(A 또는 G)과 하나의 ring을 가진 pyrimidine(T 또는 C)를 가지고 있기 때문에 각 쌍의 길이는 거의 같고 helix는 smooth cylinder를 이룰 수 있다.
각 base pair에 두 개의 bases는 같은 plane(평면)에 있고 각 pair의 plane은 helix axis와 수직을이루고 있다. Base pair는 인접한 각 pair의 면에 대해 36°돌려져 있으며 따라서 helical turn당10pairs가 존재한다. Double helix의 직경은 2nm이고 helix의 단위길이당 분자량은 약 2×106 per㎛이다. 전형적인 bacterial DNA분자의 분자량은 약 2×109이므로 그런 한 분자는 1㎜ 또는 107nm의 길이이며 매우 길고 얇은 것이다.

참고 자료

없음
DirectorY
판매자 유형Bronze개인
소개
회원 소개글이 없습니다.
전문분야
PPT양식, 경영/경제, 디자인소스
판매자 정보
학교정보
비공개
직장정보
비공개
자격증
  • 비공개

주의사항

저작권 자료의 정보 및 내용의 진실성에 대하여 해피캠퍼스는 보증하지 않으며, 해당 정보 및 게시물 저작권과 기타 법적 책임은 자료 등록자에게 있습니다.
자료 및 게시물 내용의 불법적 이용, 무단 전재∙배포는 금지되어 있습니다.
저작권침해, 명예훼손 등 분쟁 요소 발견 시 고객센터의 저작권침해 신고센터를 이용해 주시기 바랍니다.
환불정책

해피캠퍼스는 구매자와 판매자 모두가 만족하는 서비스가 되도록 노력하고 있으며, 아래의 4가지 자료환불 조건을 꼭 확인해주시기 바랍니다.

파일오류 중복자료 저작권 없음 설명과 실제 내용 불일치
파일의 다운로드가 제대로 되지 않거나 파일형식에 맞는 프로그램으로 정상 작동하지 않는 경우 다른 자료와 70% 이상 내용이 일치하는 경우 (중복임을 확인할 수 있는 근거 필요함) 인터넷의 다른 사이트, 연구기관, 학교, 서적 등의 자료를 도용한 경우 자료의 설명과 실제 자료의 내용이 일치하지 않는 경우

이런 노하우도 있어요!더보기

찾던 자료가 아닌가요?아래 자료들 중 찾던 자료가 있는지 확인해보세요

  • 파일확장자 캠벨 생명과학 11판 정리노트 Unit16 15페이지
    32P 사용4. DNA 시각화 : 이중나선구조(Double helix ... , G~C 수량 일치함 발견DNA 구조의 주요 특징이중나선(Double ... 질이DNA 복제와 수선에 함께 관여한다1. DNA 복제의 기본 모형양친분자
  • 한글파일 세포의 기본을 정리해 놓은 파일입니다. 6페이지
    . - DNA는 이중 나선(double helix)으로 꼬임 : coil ... double helix) B-DNA 보다 shorter & fatter ... - Z-DNA (Left-handed double helix) B-DNA
  • 한글파일 DNA와 RNA의 비교 및 DNA복제와 단백질 합성의 비교 3페이지
    자의 본체를 이루는 디옥시리보핵산 (DNA)와, DNA가 가진 유전정보에 따라 ... . ① DNA Gyrase가 초나선 상태의 DNA의 슈퍼코일을 helix구조만 ... 여 단일가닥 상태를 안정화시킨다. *Double Strand인 DNA
  • 워드파일 DNA/RNA 구조의 이해 4페이지
    AGCCCGCCUAAUGAGCGGGCU DNA는 이중나선 (Double Helix ... .com/causes-double-helix-twist-dna ... 중심으로 한 뉴클레오타이드를 이루는 핵산의 하나이다. DNA와 구별되는 점은
  • 한글파일 [일반생물학실험]동물과 식물의 Genomic DNA 분리 강의노트 2페이지
    뉴클레오타이드의 중합체인 데옥시리보핵산(DNA)와 당이 리보스인 ... 뉴클레오타이드의 중합체인 리보핵산(RNA)가 있다. ▶ DNA · 핵산 중 한 ... DNA와 별개로 독립적으로 복제가 될 수 있는 원형의 DNA를 말함. · 분자
  • 한글파일 세포의 기본을 정리해 놓은 파일입니다.(1) 6페이지
    pho 8. 이중 가닥 DNA의 이중나선(double helix) 구조 ... (nucleic acid)은 DNA와 RNA이고 이 핵산을 이루고 있는 기본 구성 ... 열을 가해서 죽은 병원성 박테리아의 DNA, RNA 단백질을 추출을 해서
  • 한글파일 생화학 요점 9페이지
    의 합성을 방지 3. DNA 이중나선구조의 특성 ① B-form : 가장 ... /base pairs, 4.5 nm/turn DNA RNA mRNA ... AGCU 구조 double helix 단일가닥의 특이한 3차구조 샤가프
더보기
최근 본 자료더보기
[자연과학]핵산