• AI글쓰기 2.1 업데이트
  • 통합검색(3,074)
  • 리포트(2,549)
  • 시험자료(217)
  • 자기소개서(178)
  • 논문(45)
  • 서식(31)
  • 이력서(28)
  • 방송통신대(18)
  • ppt테마(8)
  • 기간
  • 연관순
  • 영역
  • 페이지 수
  • 확장자
  • 할인자료 보기

연관검색어

lesson plan PLAN pelt 9 초등영어 지도안 영어 수업 지도안 오픽 im 영어스토리텔링
판매자 표지는 다운로드시 포함되지 않습니다.

"experimental class using active Listening" 검색결과 261-280 / 3,074건

  • 자료 표지
    blood donation ppt 발표대본 원어민 발표 대본(A+)
    the table of contents.first, What is blood donation?second. Misconceptions of blood donationthird. c ... other infections can be contracted from donating blood. the answer is no.Sterility is maintained at all ... steps. A sterile, new needle is used for each donation and is then properly discarded. Use of s
    Non-Ai HUMAN
    | 리포트 | 3페이지 | 1,000원 | 등록일 2020.12.09
    다운로드 장바구니
  • 판매자 표지 자료 표지
    학생에게 피드백을 주는 방법 What are some of the ways of giving feedback to the students 영어레포트
    in class activities and are aware of their abilities. The students naturally develop enthusiasm, c ... (2011) asserted that learners have opportunities to use their affective cognitive and reflective s ... is considered important in monitoring, evaluating, and regulating individual learners in order for
    Non-Ai HUMAN
    | 리포트 | 3페이지 | 1,000원 | 등록일 2022.08.19
    다운로드 장바구니
  • 자료 표지
    한국투자공사 KIC 정규직 신입 자소서(영문/한글)
    hother’s face and do what I can do actively, even though I am not a leader. I help others and do ... .ctice that couldn't be learned in class. I analyzed industries and companies, and applied ... SRI research. During internship, I estimated the environmental cost of companies by using the Trucost
    Non-Ai HUMAN
    | 자기소개서 | 4페이지 | 5,000원 | 등록일 2020.12.17 | 수정일 2021.09.26
    다운로드 장바구니
  • 판매자 표지 자료 표지
    이화여대 커사 커뮤니케이션과사회 영어 발표 대본 스크립트, 미국 저널리즘 객관성(Objectivity)
    middle-class and companies lead a transparent change in Journalism, too. Especially in the 1840s, after ... importance of Objectivity in American Journalism.Before getting started, we should think about the current ... Objectivity. First is advanced education, and second is the insulation from the public such as using
    Non-Ai HUMAN
    | 리포트 | 2페이지 | 2,500원 | 등록일 2022.10.07
    다운로드 장바구니
  • 자료 표지
    건국대학교 핵산생화학 중간고사 족보
    는 variants가 salt에 내성을 가진다는 것을 알 수 있다. 6. Use the experimental evidence presented here to compare the ... just one strand. This was assessed by using the circular plasmid pBR322. The plasmid is the most s ... )GCGCAATATTTCTCAAAATATTGCGC(3). Write the base sequence of the complementary strand. What special
    시험자료 | 11페이지 | 3,000원 | 등록일 2024.06.26
    다운로드 장바구니
  • 자료 표지
    브이심 Olivia Jones 100프로 요약
    ) measurement cuff.8. 대상자의 심장, 폐음을 청진한다. You listened to the heart of the patient. This is ... fetal heart rate by use of a doptone device.12. You checked the deep tendon reflexes.13. 대상자의 머리, 가슴, 팔 ... 옆에 곡반을 놓는다. You put an emesis basin at the bed side.5. 부종을 확인한다. You checked for edema.6. 호흡을 사정
    Non-Ai HUMAN
    | 리포트 | 2페이지 | 1,000원 | 등록일 2021.09.27
    다운로드 장바구니
  • 판매자 표지 자료 표지
    수소에너지에 대한 발표
    alculated using conventional baseline correction. The loss in electrochemically active Pt surface area ... ath 40 wt % Pt/Ti0.8Mo0.2O2-C support catalyst.Experimental Fig. 1 - Preparation steps of Ti0.8Mo0.2 ... omposite support with atomic ratio Ti/Mo¼80/20 was Ti0.8Mo0.2O2eC.Experimental Electrocatalysts c
    Non-Ai HUMAN
    | 리포트 | 14페이지 | 1,000원 | 등록일 2022.12.04 | 수정일 2023.01.08
    다운로드 장바구니
  • 자료 표지
    영미단편소설 A+ 수업내용 5. The Doll's House-Katherine Mansfield
    opds are mixed together with the lower working class children.Underline it also because it is related ... in the village. (should use passive voice_be p.p form)actually the word came form the Greek. Ostra ... hovered at the edge(edge of the circle, ring); you couldn’t stop them listening. Remember that they are
    Non-Ai HUMAN
    | 리포트 | 9페이지 | 1,000원 | 등록일 2021.10.21 | 수정일 2022.07.08
    다운로드 장바구니
  • 판매자 표지 자료 표지
    죽은 시인의 사회 주인공 정신분석 영문 페이퍼
    caring for Thomas Perry, I would be an active listener as well, but I would focus on the reason why he ... CareProfessorDateCharacter ReviewThe movie Dead Poets Society showed adolescents' identity crises in a highly c ... ompetitive academy, Welton Academy. Neil Perry, one of the main characters of Dead Poets Society, was an
    Non-Ai HUMAN
    | 리포트 | 7페이지 | 2,000원 | 등록일 2022.06.01
    다운로드 장바구니
  • 자료 표지
    헬스커뮤니케이션 health policy implementation critique 건강정책비평, HPV 백신
    were vaccinated .However, I am currently a 21-year-old woman, not a low-income class, who was ... using celebrities, recently, but due to high prices and lack of publicity, the HPV vaccination rate for ... vaccination is very active, the promotion of periodic tests is not well conducted. In fact, through
    Non-Ai HUMAN
    | 리포트 | 6페이지 | 2,000원 | 등록일 2022.09.10
    다운로드 장바구니
  • 판매자 표지 자료 표지
    영어면접 예상질문 및 답변 정리
    영어면접 질문 답변 정리목차* How did you get here today?* How do you usually manage stress?* If you have a c ... to work for us? why are you so passionate about this company?* 자기소개* Tell me about a time that you ... had to use public transportation. I took the bus and the subway this morning and it took about 1
    Non-Ai HUMAN
    | 자기소개서 | 4페이지 | 3,000원 | 등록일 2022.08.18
    다운로드 장바구니
  • 자료 표지
    영어 임용 수업 시연 자료
    tarting today's lesson, let's review the last class.Do you remember what we learned last time?Is there ... hope you enjoy it.Let's look at the picture/ video clip on the screen.Pre-speaking(listening ... this time, you have to choose what the story is about after listening.Are you ready?Excellent.Ok, let
    Non-Ai HUMAN
    | 시험자료 | 7페이지 | 3,300원 | 등록일 2022.02.07
    다운로드 장바구니
  • 자료 표지
    순차적무선배정방법을 적용한 체육수업 팀편성프로그램 (Students assignment program for team activities of PE class using covariate adaptive randomization)
    한국체육교육학회 김성환, 김혜진
    논문 | 14페이지 | 무료 | 등록일 2025.07.15 | 수정일 2025.07.20
    다운로드
  • 자료 표지
    대중감시와 사생활 (영문 보고서)
    timetable shows that I’m in class 2-9. So, we can make a guess that I am a DFLHS student in class 9 ... you move to another place after taking a picture. Also, when we use a kindle to read, it actually c ... , who used to be an agent in the CIA got to know about Prism, a type of system which collected user
    Non-Ai HUMAN
    | 리포트 | 3페이지 | 2,000원 | 등록일 2021.01.17
    다운로드 장바구니
  • 판매자 표지 자료 표지
    모성간호학 vSim(브이심) core 시나리오 5개 - Olivia Jones, Brenda Patton, Amelia Sung , Carla Hemandez, Fatime Sanogo
    Peri-Pad using a scale.POST1. - Be an active listener during interactions with the patient and her ... umbilical cord.6. Use a gloved hand to lift~, Assess the exposed umbilical card~.7. To relax the ... respiratory rate.- Assess her pain level using a scale of 0 to 10- Check Peri-Pad for amount, color, oue.
    Non-Ai HUMAN
    | 리포트 | 7페이지 | 4,000원 | 등록일 2021.04.14 | 수정일 2021.04.19
    다운로드 장바구니
  • 판매자 표지 자료 표지
    열유체실습 결과레포트 4
    refrigeration systems (COP) from the experimental data. Lastly, we will study the characteristics of ... pressure has to be used for calculation. So, by adding , the absolute pressure is driven.Also, the ... ** 교수님)Sungkyunkwan university,School of Mechanical Engineering2022.03.14.AbstractAir-conditioning
    Non-Ai HUMAN
    | 리포트 | 19페이지 | 2,500원 | 등록일 2022.08.21
    다운로드 장바구니
  • 자료 표지
    [영어] 광염소나타 독후감 - 칸트, 공리주의, 덕윤리를 중심으로
    his mother's efforts and religious activities. When her mother got ill, he was caught stealing money ... three representative ethical perspectives that I learned in my '생활과 윤리' class.First, a theory of c ... Title: 광염소나타The book that I'm going to introduce to you today is "광염 소나타." The main character, Baek
    Non-Ai HUMAN
    | 리포트 | 1페이지 | 1,000원 | 등록일 2021.02.16
    다운로드 장바구니
  • 자료 표지
    Tesol 테솔리스닝 레슨플랜(원어민수정완료)+수업자료/스크립트 Be healthy with vegetarianism
    - Vegetarianism Survey (20 copies)Aims:- Main Aim: Ss will improve their listening skill by doing the dictation ... -ActivityMaterials: Worksheet #1 (20 copies), BoardTimeSet UpTeacher TalkStudent Activity5minpairsProcedurePre ... e?How much time do we have?Check AnswerLet’s check the answer with your partner.Listening for
    Non-Ai HUMAN
    | 시험자료 | 12페이지 | 3,000원 | 등록일 2021.11.07 | 수정일 2021.11.28
    다운로드 장바구니
  • 자료 표지
    사회언어학 Social Networks 요약
    though he may participate in a lot of activities within group B and seems to use the community’s ... lass do. Also, social networks work as a medium of language change. To be specific, if a person who ... toward change. In the research conducted by Melancon, African Americans living in Louisiana used more
    Non-Ai HUMAN
    | 리포트 | 2페이지 | 2,000원 | 등록일 2020.12.26
    다운로드 장바구니
  • 판매자 표지 자료 표지
    수단을 위한 친화정책 방안(영문)
    , both consumers and producers, and using them more actively to increase productivity. This change ... Poverty Watch defines the class that solves consciousness as the poorest people with less than $1.9 ... national flag of South SudanRepublic of South Sudan is one of the developing countries. Republic of
    Non-Ai HUMAN
    | 리포트 | 5페이지 | 1,000원 | 등록일 2022.05.03 | 수정일 2022.05.13
    다운로드 장바구니
  • 전문가요청 배너
해캠 AI 챗봇과 대화하기
챗봇으로 간편하게 상담해보세요.
2025년 11월 29일 토요일
AI 챗봇
안녕하세요. 해피캠퍼스 AI 챗봇입니다. 무엇이 궁금하신가요?
9:59 오전
문서 초안을 생성해주는 EasyAI
안녕하세요 해피캠퍼스의 20년의 운영 노하우를 이용하여 당신만의 초안을 만들어주는 EasyAI 입니다.
저는 아래와 같이 작업을 도와드립니다.
- 주제만 입력하면 AI가 방대한 정보를 재가공하여, 최적의 목차와 내용을 자동으로 만들어 드립니다.
- 장문의 콘텐츠를 쉽고 빠르게 작성해 드립니다.
- 스토어에서 무료 이용권를 계정별로 1회 발급 받을 수 있습니다. 지금 바로 체험해 보세요!
이런 주제들을 입력해 보세요.
- 유아에게 적합한 문학작품의 기준과 특성
- 한국인의 가치관 중에서 정신적 가치관을 이루는 것들을 문화적 문법으로 정리하고, 현대한국사회에서 일어나는 사건과 사고를 비교하여 자신의 의견으로 기술하세요
- 작별인사 독후감
“EasyAI 가 작성한 문서 초안은 완벽하지 않을 수 있습니다"
EasyAI 이동하기