생물정보학 Glucansucrase를 조작 및 주문 시퀸싱 일련과정의 정리

최초 등록일
2008.06.11
최종 저작일
2007.06
105페이지/파워포인트파일 MS 파워포인트
가격 2,000원 할인쿠폰받기
판매자cri**** 3회 판매
다운로드
장바구니

소개글

생물정보학 Glucansucrase를 조작 및 주문 시퀸싱 일련과정의 정리

목차

없음

본문내용

Dotlet 실행 불가
rna.wustl.edu/GtRDB/Hin/Hin-seqs.html 접속 불가
Similarity Searches on Sequence Databases
The most popular Data-Mining Tool Ever: BLAST
① NCBI /BLAST 접속
※ Running the NCBI blastp
② ndow.
③ Save my result.
※ Running the EMBnet blastp
① EMBnet 접속
② Choose blastp
③ choose the SwissProt
④ Click the Run BLAST
⑤ Results
- An overview of the BLAST output
⑤ Results
- The graphic display
⑤ Results
- The hit list
⑤ Results
⑤ Results
※ Making Iterative BLAST with PSI-BLAST
※ PSI-BLASTing protein sequences
① BLAST → PSI- and PSH-BLAST
② PSI-BLAST Number 1000
③ Click the BLAST
④ Inspect the results
⑤ Click the Run PSI-BLAST Iteration 2 Button
⑥ Result the Iteration 2
⑦ Click the PSI-BLAST Iteration 3
⑧ Result the Iteration 3
⑨ Click the Iteration 4
⑩ Result the Iteration 4
Comparing Two Sequences
※ Using Dotlet over the Internetㅊ
* Entering my sequence in Dotlet
① Enter the Dotlet
② Ctrl+N 창 2개를 띄워놓은다.
③ Search the FASTA sources
④ Copy the FASTA
Dotlet이 실행이 되지 않아 교수님께서 주신 자료를 이용했습니다.
※ Using Lalign to find the ten best local alignments
① Embnet Lalign 접속
② Choose the number of reported subalignment
- 10개의 보고서 영역을 검색하고 싶을 땐, 10을 선택해준다.
③ Choose the Scoring matrix
- BLOSUM은 일반적으로 PAM보다 낫다.
- BLOSUM80을 BLOSUM45대신에 적용하면, the Local alignmnets는 짧아지는 경향이 있다.
④ Results
Building a Multiple Sequence Alignment
※ Choosing the Right Sequences
* Gathering your sequences with online BLAST servers
▶ Selecting sequences on the ExPASy server
① www.expasy.ch/cgi-bin/BLASTEMBnet-CH.pl.
② Enter the sequence Accession Number
③ Select the Search only Swiss-Prot
④ Select the Sequences Show 1000
⑤ Select the Alignments Show 1000
⑥ E-mail로 Results를 전송 받는다.
⑦ E-mail로 Results 확인

참고 자료

없음

자료문의

ㆍ이 자료에 대해 궁금한 점을 판매자에게 직접 문의 하실 수 있습니다.
ㆍ상업성 광고글, 욕설, 비방글, 내용 없는 글 등은 운영 방침에 따라 예고 없이 삭제될 수 있습니다.
ㆍ다운로드가 되지 않는 등 서비스 불편사항은 고객센터 1:1 문의하기를 이용해주세요.

판매자 정보

cri****
회원 소개글이 없습니다.
판매지수
ㆍ판매 자료수
7
ㆍ전체 판매량
99
ㆍ최근 3개월 판매량
0
ㆍ자료후기 점수
받은후기없음
ㆍ자료문의 응답률
받은문의없음
판매자 정보
ㆍ학교정보
  • 비공개
ㆍ직장정보
  • 비공개
ㆍ자격증
  • 비공개
  • 위 정보 및 게시물 내용의 진실성에 대하여 해피캠퍼스는 보증하지 아니하며, 해당 정보 및 게시물 저작권과 기타 법적 책임은 자료 등록자에게 있습니다.
    위 정보 및 게시물 내용의 불법적 이용, 무단 전재·배포는 금지되어 있습니다.
    저작권침해, 명예훼손 등 분쟁요소 발견시 고객센터의 저작권침해 신고센터를 이용해 주시기 바랍니다.

    찾던 자료가 아닌가요?아래 자료들 중 찾던 자료가 있는지 확인해보세요

    • 파일확장자 고려대학교 세종캠퍼스 생물정보학 homework2 (NCBI, BLAST) 12페이지
      ? Start from Hyperlink "http://blast.ncbi.nlm ... .nih.gov/Blast.cgi" http://blast.ncbi.nlm ... blast. -NCBI에서 papaya papain을 검색하여 BLAST
    • 워드파일 NCBI database search 실험 보고서 5페이지
      연결되어 있다. * Bioinformatics - 분자생물학 분야에서 통계 ... 국립생물정보센터)에 들어가서 오른쪽 상단의 blast를 누른 후 ... 백과 ‘biological database’ - 위키백과 ‘NCBI’ - NCBI 홈페이지 ‘BLAST’ - 식물유전공학 수업 PPT
    • 한글파일 [일반생물학실험]Bioinformatics & Sequencing 10페이지
      원리 가. 생물정보학 1) 컴퓨터를 이용하여 생물학을 연구하는 모든 ... 가공 처리하여 유용한 정보를 얻어내는 학문을 생물정보학이라고 함 4) 인간 ... 정보를 가공 처리하여 유용한 정보를 얻어내는 학문을 생물정보학이라고 한다
    • 한글파일 [생물학실험] [서울대] 생물정보학 (Bioinformatics), 계통수 그리기, Protein Blast, NCBI 5페이지
      생물정보학 (Bioinformatics) 1. 계통수 그리 ... sequence Blast 결과 (중략) 계통수 (phylogenetic ... TGAAATATAGTGGAAACTTAATGAAG Blast 결과 Gene
    • 한글파일 아주대학교 A+생명과학실험(생과실) 12과 생명정보학 5페이지
      위한 URL이 되겠다. - BLAST (http://blast.ncbi ... 실험12. 생명정보학 1. Introduction - 생명정보학 ... 이란 컴퓨터를 이용하여 생물학을 연구하는 모든 분야를 포함하는 학문으로서 유전
    • 워드파일 서울대학교 생물학실험1 보고서! 생물정보학 보고서입니다 정리잘되고 알찬 깔끔한 보고서! 3페이지
      생물학실험 보고서 – 생물정보학 I. 실험목표 컴퓨터를 통해 구축된 ... 및 실험원리 가. 생물정보학 컴퓨터를 이용하여 생물학을 연구하는 모든 ... 학문을 생물정보학이라고 한다. 따라서 생물정보학은 컴퓨터를 이용하여 생물
    • 한글파일 NCBI 사이트 이용법에 대한 레포트 4페이지
      약자로, 생물정보학의 연구에서 가장 많이 사용되고 있는 분석 방법이다 ... 성을 가진 서열을 쉽게 찾아낼 수 있게 되었다. BLASTNCBI ... NCBI 사이트 이용법 NCBI는 미국립보건원(NIH: National
    더보기
    상세하단 배너
    우수 콘텐츠 서비스 품질인증 획득
    최근 본 자료더보기
    생물정보학 Glucansucrase를 조작 및 주문 시퀸싱 일련과정의 정리